FreshPatents.com Logo
Enter keywords:  

Track companies' patents here: Public Companies RSS Feeds | RSS Feed Home Page
Popular terms

[SEARCH]

Follow us on Twitter
twitter icon@FreshPatents

Web & Computing
Cloud Computing
Ecommerce
Search patents
Smartphone patents
Social Media patents
Video patents
Website patents
Web Server
Android patents
Copyright patents
Database patents
Programming patents
Wearable Computing
Webcam patents

Web Companies
Apple patents
Google patents
Adobe patents
Ebay patents
Oracle patents
Yahoo patents

[SEARCH]

Recur patents



      
           
This page is updated frequently with new Recur-related patent applications. Subscribe to the Recur RSS feed to automatically get the update: related Recur RSS feeds. RSS updates for this page: Recur RSS RSS


Method and system for using a recursive event listener on a node in hierarchical data structure

Gathering index statistics using sampling

Adaptive and recursive system and method

Date/App# patent app List of recent Recur-related patents
07/24/14
20140208207
 Multiple-frame screenshot patent thumbnailMultiple-frame screenshot
Various embodiments are generally directed to cooperation among networked devices to obtain and use a multiple-frame screenshot. In one embodiment, an apparatus comprises a processor circuit executing instructions that cause the processor circuit to receive a signal conveying a video stream from a source device; visually present video frames of the video stream on a display associated with the apparatus; maintain a rolling buffer comprising a plurality of video frames; recurringly update the plurality of video frames to represent a subset of video frames of the video stream most recently presented on the display; receive a signal indicative of a capture command; and preserve the subset of video frames as a multiple-frame screenshot in response to the capture command..
07/24/14
20140207940
 Method and system for using a recursive event listener on a node in hierarchical data structure patent thumbnailMethod and system for using a recursive event listener on a node in hierarchical data structure
Disclosed is a method and system for registering a recursive watch on a node in hierarchical data structure. Embodiments of the disclosed technique may include (i) receiving a request to register an event listener on a source node, the source node being one of a plurality of nodes that are related to each other in a hierarchy; (ii) registering the event listener on the source node, the event listener configured to notify a client of an occurrence of a first event in the source node; and (iii) if the source node has a descendant node in the hierarchy, setting the event listener to notify the client of an occurrence of a second event in the descendant node without requiring registration of another event listener on the descendant node.
07/24/14
20140207754
 Gathering index statistics using sampling patent thumbnailGathering index statistics using sampling
An approach is provided in which a sample point system allocates sample point identifiers to a root node included an index tree that includes multiple leaf nodes. The sample point system distributes the sample point identifiers to the root node's child nodes, and recursively traverses through the index tree's hierarchical index levels and distributes the sample point identifiers from the child nodes to a subset of the index tree's leaf nodes.
07/24/14
20140207582
 Adaptive and recursive system and method patent thumbnailAdaptive and recursive system and method
A system and method of advertising based on the automatic determination of an advertising recipient's location and inferences of preferences derived from usage behaviors is disclosed. The advertising recipient's location that is considered in delivering a specific advertisement may be the current location or one or more historical locations.
07/24/14
20140207132
 Treatment system patent thumbnailTreatment system
A treatment system includes a treatment instrument that has a pair of freely openable/closable holding sections for applying thermal energy generated by a heat generation section to a living tissue lt held between the holding sections, a signal output section that supplies an alternating current drive signal to the heat generation section, a setting section that sets a target temperature of the heat generation section, a signal detection section that detects a current and a voltage of the drive signal, a control section that controls a temperature of the heat generation section by adjusting power of the drive signal, a signal extraction section that extracts a direct current component from the drive signal detected by the signal detection section and a fault detection section that detects a precursory phenomenon of a fault of the heat generation section based on the extracted signal extracted by the signal extraction section.. .
07/24/14
20140206901
 Recombinant microorganisms and methods of use thereof patent thumbnailRecombinant microorganisms and methods of use thereof
The invention relates to methods for the production of chemical compounds, particularly but not exclusively ethanol, by microbial fermentation. Also described are genetically modified micro-organisms capable of using carbon monoxide to produce one or more products, particularly but not exclusively ethanol as a main product, and producing a reduced amount or substantially no 2,3-butanediol and/or a precursor thereof..
07/24/14
20140206871
 Low abuk oxycodone, its salts and methods of making same patent thumbnailLow abuk oxycodone, its salts and methods of making same
A method of preparing oxycodone includes forming 14-hydroxycodeine by reduction of 14-hydroxycodeinone and rearrangement of the 14-hydroxycodeine to form the oxycodone. During the reduction step, the ketone group of an undesirable contaminant precursor, 8,14-dihydroxy-7,8-dihydrocodeinone, is reduced to a hydroxyl group thus forming a triol.
07/24/14
20140206869
 Iridium containing hydrosilylation catalysts and compositions containing the catalysts patent thumbnailIridium containing hydrosilylation catalysts and compositions containing the catalysts
A composition contains (a) a hydrosilylation reaction catalyst and (b) an aliphatically unsaturated compound having an average, per molecule, of one or more aliphatically unsaturated organic groups capable, of undergoing hydrosilylation reaction. The composition is capable of reacting via hydrosilylation reaction to form a reaction product, such as a silane, a gum, a gel, a rubber, or a resin.
07/24/14
20140206863
 Copper containing hydrosilylation catalysts and compositions containing the catalysts patent thumbnailCopper containing hydrosilylation catalysts and compositions containing the catalysts
A composition contains (a) a hydrosilylation reaction catalyst and (b) an aliphatically unsaturated compound having an average, per molecule, of one or more aliphatically unsaturated organic groups capable of undergoing hydrosilylation reaction. The composition capable of reacting via hydrosilylation reaction to form a reaction product, such as a silane, a gum, a gel, a rubber, or a resin.
07/24/14
20140206838
 Compositions and methods for recognition of rna using triple helical peptide nucleic acids patent thumbnailCompositions and methods for recognition of rna using triple helical peptide nucleic acids
Peptide nucleic acids containing thymidine and 2-aminopyridine (m) nucleobases formed stable and sequence selective triple helices with double stranded rna at physiologically relevant conditions. The m-modified pna displayed unique rna selectivity by having two orders of magnitude higher affinity for the double stranded rnas than for the same dna sequences.
07/24/14
20140206837
Targeting vector-phospholipid conjugates
Peptide vectors having high kdr binding affinity and processes for making such vectors are provided. The peptide vectors may be conjugated to phospholipids and included in ultrasound contrast agent compositions.
07/24/14
20140206791
Dispersions of nanoscale dental glass particles and methods for preparing the same
Provided are a dispersion of a nanoparticulate mixed oxide of sio2 with at least one further metal oxide in a matrix monomer, methods for preparing such a dispersion, a dental composite producible by curing such a dispersion, and uses of the dispersion as a precursor for dental composites.. .
07/24/14
20140206687
Quinazoline derivative, preparation method therefor, intermediate, composition and application thereof
Disclosed are as represented by formula (i) a quinazoline derivative and a pharmaceutical acceptable salt thereof, or, an enantiomer, a non-enantiomer, a tautomer, a racemate, a solvate, a metabolic precursor, or a prodrug of both. Also disclosed are a preparation method therefor, an intermediate, a pharmaceutical composition having the quinazoline derivative, and an application thereof.
07/24/14
20140206630
Phenolic coatings and methods of making and using same
A method of making a facile, surface-independent, polyphenol coating is disclosed. In general, the method includes contacting at least a portion of the substrate to be coated with an aqueous solution containing one or more salts and one or more nitrogen-free phenolic compounds.
07/24/14
20140206529
Apparatus and method for manufacturing silica-titania catalyst
Provided are an apparatus and method for preparing a silica-titania catalyst. The apparatus for preparing a silica-titania catalyst, comprising: precursor supplying units; an oxygen supplying line; a reaction unit; and a recovering unit, wherein the precursor supplying units vaporize a silica precursor and titania precursor and supply them to the reaction unit, wherein the oxygen supplying line supplies an oxygen source to the reaction unit, wherein the reaction unit converts vaporizates of the silica precursor and titania precursor supplied from the precursor supplying units to produce a silica-titania catalyst, wherein the recovering unit cools, condenses and collects the silica-titania catalyst produced at the reaction unit, wherein the recovering unit comprises a cooler for cooling the silica-titania catalyst introduced from the reaction unit, and the cooler comprises a turbulence-forming section on a flow path of the silica-titania catalyst..
07/24/14
20140206528
Porous body precursors, shaped porous bodies, processes for making them, and end-use products based upon the same
The present invention provides porous body precursors and shaped porous bodies. Also included are catalysts and other end-use products based upon the shaped porous bodies and thus the porous body precursors.
07/24/14
20140206251
Surface modifying agents, modified materials and methods
The present invention relates to surface modifying agents for polymeric and/or textile materials, methods of making and/or using a surface modifying agent to modify and functionalize polymeric and/or textile materials, and/or methods of using surface modified or functionalized polymeric and textile materials, and/or products using or incorporating surface modified or functionalized polymeric and textile materials. For example, the surface modifying agent in precursor form can be styrene sulfonyl azide monomer, polymer or copolymer capable of undergoing a chemical reaction in the presence of heat or light to form one or more styrene sulfonated nitrene monomers, polymers or copolymers, which are capable of chemically reacting with the surface of a polymeric or textile material to endow a specific or desired chemical surface functionality to the surface of a polymeric or textile material.
07/24/14
20140206195
Process for removing carbon material from substrates
A method of removing carbon materials, preferably amorphous carbon, from a substrate includes dispensing a liquid sulfuric acid composition including sulfuric acid and/or its desiccating species and precursors and having a water/sulfuric acid molar ratio of no greater than 5:1 onto an material coated substrate in an amount effective to substantially uniformly coat the carbon material coated substrate. The liquid sulfuric acid composition is exposed to water vapor in an amount effective to increase the temperature of the liquid sulfuric acid composition above the temperature of the liquid sulfuric acid composition prior to exposure to the water vapor.
07/24/14
20140206190
Silicide formation in high-aspect ratio structures
Embodiments of the present invention include methods of forming a silicide layer on a semiconductor substrate. In an exemplary embodiment, a metal layer may first be deposited above a semiconductor substrate using a chemical vapor deposition process with a metal amidinate precursor and then the semiconductor substrate may be annealed, causing the semiconductor substrate to react with the metal layer forming a metal-rich silicide layer on the semiconductor substrate.
07/24/14
20140206136
Antimony compounds useful for deposition of antimony-containing materials
Precursors for use in depositing antimony-containing films on substrates such as wafers or other microelectronic device substrates, as well as associated processes of making and using such precursors, and source packages of such precursors. The precursors are useful for deposition of ge2sb2te5 chalcogenide thin films in the manufacture of nonvolatile phase change memory (pcm) or for the manufacturing of thermoelectric devices, by deposition techniques such as chemical vapor deposition (cvd) and atomic layer deposition (ald)..
07/24/14
20140206134
Low temperature deposition of phase change memory materials
A system and method for forming a phase change memory material on a substrate, in which the substrate is contacted with precursors for a phase change memory chalcogenide alloy under conditions producing deposition of the chalcogenide alloy on the substrate, at temperature below 350° c., with the contacting being carried out via chemical vapor deposition or atomic layer deposition. Various tellurium, germanium and germanium-tellurium precursors are described, which are useful for forming gst phase change memory films on substrates..
07/24/14
20140206132
Method for indium sputtering and for forming chalcopyrite-based solar cell absorber layers
Cuga layer are also provided and a thermal processing operation causes the selenization of the metal precursor layers. The thermal processing operation/selenization operation converts the metal precursor layers to an absorber layer.
07/24/14
20140205972
Glass ceramic material and method
The present invention relates to a method for manufacturing of a glass ceramic material for dental applications. The method comprises: providing a first precursor comprising silicon(iv); providing a second precursor comprising zirconium(iv); hydrolyzing said first precursor and second precursor in solution; polymerizing of the hydrolysed first precursor and second precursor in a solvent, wherein polymers are formed; formation of colloids comprising said polymers; formation of a gel from said colloids; aging the gel; drying the gel; and sintering the gel under formation of a glass ceramic material..
07/24/14
20140205930
Catalyst production method, electrode catalyst for fuel cell produced by this method, and catalyst production apparatus
A method for producing a catalyst supporting a metal or an alloy on a support, including: independently controlling a temperature of a first supercritical fluid to be first temperature, the first supercritical fluid containing a precursor of the metal or precursor of the alloy that is dissolved in a supercritical fluid; independently controlling a temperature of the support to be a second temperature higher than the temperature of the first supercritical fluid; and supplying the first supercritical fluid controlled to the first temperature to the support, to cause the metal or the alloy to be supported on the support.. .
07/24/14
20140205846
Multi-dimensional networks
Described herein are multi-dimensional networks that can include a recurring unit of formula (i) and a recurring unit of formula (ii), and methods of synthesizing and using the same.. .
07/24/14
20140205766
Surface nanoreplication using polymer nanomasks
Methods for replicating a nanopillared surface include applying a nanopillar-forming material to a surface of a replica substrate to form a precursor layer on the replica-substrate surface. A template surface of a nanomask may be contacted to the precursor layer.
07/24/14
20140205756
Iron pyrite thin films from molecular inks
Systems and methods are provided for fabricating pyrite thin films from molecular inks. A process is provided that comprises dissolving simple iron-bearing and sulfur-bearing molecules in an appropriate solvent and then depositing the solution onto an appropriate substrate using one of several methods (roll-to-roll coating, spraying, spin coating, etc.), resulting in a solid film consisting of the molecules.
07/24/14
20140205750
Cathode active material coating
Embodiments of the present disclosure relate to apparatus and methods for forming particles of cathode active materials with a thin protective coating layer. The thin protective coating layer improves cycle and safety performance of the cathode active material.
07/24/14
20140205617
Compositions and methods for treatment of neoplastic disease
The present invention comprises the use of sickle cells or sickle cell precursors loaded with a therapeutic agent that localize in tumors and induce a tumoricidal response.. .
07/24/14
20140205528
Process for preparing a composition comprising synthetic mineral particles and composition
A process for preparing a composition including synthetic mineral particles, in which a hydrogel which is a precursor of the synthetic mineral particles is prepared via a coprecipitation reaction between at least one compound including silicon, and at least one compound including at least one metal element, characterized in that the coprecipitation reaction takes place in the presence of at least one carboxylate salt of formula r2—coom′ in which: —m′ denotes a metal chosen from the group made up of na and k, and —r2 is chosen from h and alkyl groups including fewer than 5 carbon atoms. A composition including synthetic mineral particles which is obtained by such a process is also described..
07/24/14
20140204159
Mixed organosiloxane networks for tunable surface properties for blanket substrates for indirect printing methods
A crosslinked siloxane composition contains the polymerization product of a mixture containing from about 2 to about 12 alkoxysilane precursor materials, where at least one of the alkoxysilane precursor materials is a hydrophilic alkoxysilane precursor material, and at least one of the alkoxysilane precursor materials is a hydrophobic alkoxysilane precursor material. A method of printing an image to a substrate involves applying an inkjet ink to an intermediate transfer member using an inkjet printhead, spreading the ink onto the transfer member, inducing a property change of the ink, and transferring the ink to a substrate, where the intermediate transfer member comprises a crosslinked siloxane composition containing the polymerization product of a mixture comprising from about 2 to about 12 alkoxysilane precursor materials, where at least one of the precursor materials is hydrophilic and at least one is hydrophobic..
07/24/14
20140204092
Classification of high dimensional data
A method for classification of high dimensional data on graphs based on the ginzburg-landau functional. The method applies l2 gradient flow minimization of the ginzburg-landau diffuse interface energy functional to the case of functions defined on graphs.
07/24/14
20140203434
Semiconductor integrated circuit and fabricating the same
A method of fabricating a semiconductor integrated circuit (ic) is disclosed. The method includes receiving a precursor.
07/24/14
20140202349
Process for making lithographic printing plate
A process for making a lithographic printing plate enables a one-bath processable lithographic printing plate having excellent printing durability, ink laydown and resistance to staining during printing. The process includes a step of producing a negative-working lithographic printing plate precursor having, above a support, a photopolymerizable photosensitive layer containing a vinylcarbazole compound-derived monomer unit-containing acrylic polymer and/or a urethane-acrylic hybrid polymer, a step of image-wise exposing the negative-working lithographic printing plate precursor, and a step of developing the exposed negative-working lithographic printing plate precursor by means of a developer having a ph of 4 to 10, comprising (component a) a compound represented by formula (i) and/or formula (ii) below and (component b) water, and having an organic solvent content of less than 5 mass %.
07/24/14
20140202206
Methods and equipment for treatment of odorous gas steams
A method for removing noxious, hazardous, toxic, mutagenic, and/or carcinogenic compounds and/or precursor compounds from a comingled gas, liquid and/or solid stream is described. In one embodiment, the method includes optionally passing the stream through an ambient temperature condenser followed by passing the stream through a spray venturi scrubber, a chilled condenser, a gas/solid separator, and a series of wet scrubbers to remove at least a portion of the compounds..
07/17/14
20140201277
System, methods, and computer program products for contextual collaborative updates for recurring meetings
A method of informing a first entity of an activity of a second entity. The activity of the second entity during a period between a first time and a second time is tracked, the period between the first time and the second time being between a time of a first meeting and a time of a second meeting.
07/17/14
20140201208
Classifying samples using clustering
An unlabeled sample is classified using clustering. A set of samples containing labeled and unlabeled samples is established.
07/17/14
20140200928
Methods and apparatus for automated web portal and voice system data aggregation
Methods and apparatus for automating the process for researching medical claims and/or eligibility, as well as standardizing and analyzing the resulting data are. These methods include automated processes for researching an insurance claim, comprising steps of interactively and recursively querying search fields in a web portal(s) and/or phone system(s), aggregating the information from multiple sources into a standardized format in a database table(s).
07/17/14
20140200659
Capping bioprosthetic tissue to reduce calcification
A treatment for bioprosthetic tissue used in implants or for assembled bioprosthetic heart valves to reduce in vivo calcification. The method includes applying a calcification mitigant such as a capping agent or an antioxidant to the tissue to specifically inhibit oxidation in tissue.
07/17/14
20140200349
Manganese containing hydrosilylation catalysts and compositions containing the catalysts
A composition contains (a) a hydrosilylation reaction catalyst and (b) an aliphatically unsaturated compound having an average, per molecule, of one or more aliphatically unsaturated organic groups capable of undergoing hydrosilylation reaction. The composition is capable of reacting via hydrosilylation reaction to form a reaction product, such as a silane, a gum, a gel, a rubber, or a resin.
07/17/14
20140200348
Vanadium containing hydrosilylation catalysts and compositions containing the catalysts
A composition contains (a) a hydrosilylation reaction catalyst and (b) an aliphatically unsaturated compound having an average, per molecule, of one or more aliphatically unsaturated organic groups capable of undergoing hydrosilylation reaction. The composition capable of reacting via hydrosilylation reaction to form a reaction product, such as a silane, a gum, a gel, a rubber, or a resin.
07/17/14
20140200347
Rhenium containing hydrosilylation catalysts and compositions containing the catalysts
A composition contains (a) a hydrosilylation reaction catalyst and (b) an aliphatically unsaturated compound having an average, per molecule, of one or more aliphatically unsaturated organic groups capable of undergoing hydrosilylation reaction. The composition capable of reacting via hydrosilylation reaction to form a reaction product, such as a silane, a gum, a gel, a rubber, or a resin.
07/17/14
20140200345
Production method for 2-alkenylamine compound
Provided is a method for producing a 2-alkenylamine compound efficiently and at low cost, using a primary or secondary amine compound and a 2-alkenyl compound as the starting materials therefor. The 2-alkenyleamine compound is produced by 2-alkenylating a primary or secondary amine compound, using a specified 2-alkenylating agent and in the presence of a catalyst comprising a complexing agent and a transition metal precursor stabilized by a monovalent anionic five-membered conjugated diene..
07/17/14
20140200313
Method for preparing dialkyl magnesium compounds by ethylene polymerisation and uses thereof
A process for the preparation by ethylene polymerization of at least one dialkyl magnesium compound of formula r—(ch2—ch2)n—mg—(ch2—ch2)m—r′ in which r and r′, identical or different, represent aryl, benzyl, allyl or alkyl groups and in which the integers n and m, identical or different, represent average —ch2—ch2— chain formation numbers greater than 1, the process including a single stage of mixing the following components: at least one ligand or one ligand precursor, at least one rare earth salt, at least one dialkyl magnesium compound of formula r—mg—r′, and ethylene, in a medium allowing contact between the components of the above mixture.. .
07/17/14
20140200300
Precursor polyelectrolyte complexes compositions
The invention relates to compositions and methods of treatment employing compositions comprising polyelectrolyte complexes. The compositions include a water-soluble first polyelectrolyte bearing a net cationic charge or capable of developing a net cationic charge and a water-soluble second polyelectrolyte bearing a net anionic charge or capable of developing a net anionic charge.
07/17/14
20140200234
Adjuvant chemotherapy for anaplastic gliomas
The present invention involves the use of 2,4-disulfonyl phenyl tert-butyl nitrone (2,4-ds-pbn) in the treatment and prevention of gliomas. The 2,4-ds-pbn may be used alone or combined with other traditional chemo- and radiotherapies and surgery, to treat or prevent glioma occurrence, recurrence, spread, growth, metastasis, or vascularization..
07/17/14
20140200201
Enzymatic production or chemical synthesis and uses for 5,7-dienes and uvb conversion products thereof
Provided herein are steroidal compounds that are androsta-5,7-dienes or a pregna-5,7-dienes and ultraviolet b (uvb) conversion products thereof which includes pharmaceutical compositions of the steroidal compounds as shown in tables 1 and 2. Also provided is a method for producing hydroxylated metabolites of cholecalciferol or ergocalciferol via the p450scc (cyp11a1) or cyp27b1 enzyme systems where the hydroxylase has an activity to hydroxylate position c20 of a secosteroid or its 5,7-dieneal precursor and the hydroxylated metabolites so produced.
07/17/14
20140199915
Novel enhanced filamentous silicone products and processes
Filamentous bodies which are longitudinally extended and other film-like constructions are made by combining liquid siliceous precursors with air and extruding them. Distinct types or grades of fibers, strands, and other film-like constructions are produced which have a multiplicity of useful applications and indications for use owing to their inherent memory, compactability, tensile strength and density.
07/17/14
20140199850
Dry-etch for selective oxidation removal
Methods of selectively etching tungsten oxide relative to tungsten, silicon oxide, silicon nitride and/or titanium nitride are described. The methods include a remote plasma etch formed from a fluorine-containing precursor and/or hydrogen (h2).
07/17/14
20140199800
Luminescent materials that emit light in the visible range or the near infrared range and methods of forming thereof
Luminescent materials and methods of forming such materials are described herein. A method of forming a luminescent material includes: (1) providing a source of a and x, wherein a is selected from at least one of elements of group 1, and x is selected from at least one of elements of group 17; (2) providing a source of b, wherein b is selected from at least one of elements of group 14; (3) subjecting the source of a and x and the source of b to vacuum deposition to form a precursor layer over a substrate; (4) forming an encapsulation layer over the precursor layer to form an assembly of layers; and (5) heating the assembly of layers to a temperature theat to form a luminescent material within the precursor layer..
07/17/14
20140199637
Pattern forming process
A pattern is formed by coating a first chemically amplified positive resist composition comprising a resin comprising recurring units having an acid labile group so that it may turn soluble in alkaline developer upon elimination of the acid labile group, a photoacid generator, and a first organic solvent, onto a processable substrate, prebaking, exposing, peb, and developing in an alkaline developer to form a positive pattern; heating the positive pattern to render it resistant to a second organic solvent used in a second resist composition; coating the second resist composition, prebaking, exposing, peb, and developing in a third organic solvent to form a negative pattern. The positive pattern and the negative pattern are simultaneously formed..
07/17/14
20140199478
Method for producing carbon membrane
Provided is a method of producing a carbon membrane including dipping a porous support in a suspension of a phenolic resin or a suspension of a phenolic resin precursor, drying the resulting support to form a membrane made of the phenolic resin or the phenolic resin precursor, and heat treating and thereby carbonizing the resulting membrane into a carbon membrane.. .
07/17/14
20140199402
Novel compounds for the treatment of inflammatory bowel disease
The present invention relates to a nucleic acid molecule of up to 150 nucleotides comprising consecutively from 5′ to 3′ (a) a first part whose sequence is between 50% and 100% complementary to the sequence aaaagcuggguugagagggcga; (b) a second part capable of forming a loop between the first and the third part; and (c) a third part comprising or consisting of the sequence aaaagcuggguugagagggcga; for use as a medicament. The present invention further relates to a nucleic acid molecule of up to 25 nucleotides comprising the sequence aaaagcuggguugagagggcga, for use as a medicament.
07/17/14
20140199278
Brown adipocyte modification
Methods and therapeutics are provided for treating metabolic disorders by increasing activation of brown adipose tissue. Generally, the methods and therapeutics can increase activation of brown adipose tissue to increase energy expenditure and induce weight loss.
07/17/14
20140197583
Ceramic composition and ceramic injection-molding process
A ceramic composition for an injection-molding process for producing a combustion chamber pressure sensor, in particular for producing an insulation punch of a combustion chamber pressure sensor, includes a ceramic component in a proportion of greater than or equal to 50% by weight and a glass component in a proportion of less than or equal to 50% by weight. The ceramic component includes aluminum oxide.
07/17/14
20140197351
Lithium-ion-conducting materials
Lithium-ion-conducting ceramic materials are disclosed having characteristics of high lithium-ion conductivity at low temperatures, good current efficiency, and stability in water and corrosive media under static and electrochemical conditions. Some general formulas for the lithium-ion-conducting materials include mi1+x+z-δmiiixmivaymivb2-x-ymvzp3-zo12 and mi1+x+4z-δmiiixmivaymivb2-x-y-zp3o12, wherein mi comprises li, na, or mixtures thereof; 0.05<x<0.5, 0.05<y<2, 0≦z<3, and 0≦δ<0.5; miii comprises al, hf, sc, y, la, or mixtures thereof; miva comprises zr, ge, sn, or mixtures thereof; mivb comprises ti; and mv comprises si, ge, sn, or mixtures thereof.
07/17/14
20140196529
System and method for sensing and managing pothole location and pothole characteristics
The present invention provides a system and method for sensing and managing pothole locations and pothole characteristics. An additional aspect of the present invention is to provide a system that may acquire, fuse, and analyze pothole sensing data from several sources to identify potholes in need of maintenance or repair.
07/17/14
20140196222
Conditioning dyeing agent for keratinous fibers
The specification describes an agent for coloring keratinic fibers. The agent includes, in a cosmetically acceptable carrier, at least one oxidation dye precursor, a precursor of a nature-analogous dye, a substantive dye, or combinations thereof.
07/10/14
20140196009
Module structural analysis supporting device and program
A device supporting the structural analysis of a module comprises: a storage means storing at least one module; and a conversion means that converts a prescribed target module among the modules stored by the storage means to a secondary module and stores same in the storage means. The conversion means reads the target module from the storage means and sequentially outputs to the secondary module each sentence written from a prescribed processing start location in the target module to a prescribed processing end location.
07/10/14
20140195692
Robust domain name resolution
A recursive dns nameserver system and related domain name resolution techniques are disclosed. The dns nameservers utilize a local cache having previously retrieved domain name resolution to avoid recursive resolution processes and the attendant dns requests.
07/10/14
20140195433
Upgrading of recurring payment cancellation services
A method of reducing chargebacks due to a cancelled recurring payment, wherein the payment occurs within a card-based financial network, and wherein the network includes a database of unauthorized recurring charges and a defined chargeback procedure. The method generally includes the step of upgrading a recurring payment cancellation services file based on predefined occurrences relating to the identifying of cancelled recurring payments..
07/10/14
20140195200
Smart data sampling and data reconstruction
A computer-based method for characterizing data dependent on at least one variable is described. The method comprises sampling the data in a smart manner by sampling the data in a finite sequence of sampling points, the finite sequence of sampling points being controlled by a magnifying factor for controlling a spacing between elements of the finite sequence of sampling points and being determined such that function values of functions of a family of functions in said finite sequence of sampling points satisfy a recurrence relation.


Popular terms: [SEARCH]



Follow us on Twitter
twitter icon@FreshPatents

###

This listing is a sample listing of patent applications related to Recur for is only meant as a recent sample of applications filed, not a comprehensive history. There may be associated servicemarks and trademarks related to these patents. Please check with patent attorney if you need further assistance or plan to use for business purposes. This patent data is also published to the public by the USPTO and available for free on their website. Note that there may be alternative spellings for Recur with additional patents listed. Browse our RSS directory or Search for other possible listings.
     SHARE
  
         


FreshNews promo



0.252

3046

0 - 1 - 73