FreshPatents.com Logo
Enter keywords:  

Track companies' patents here: Public Companies RSS Feeds | RSS Feed Home Page
Popular terms

[SEARCH]

Follow us on Twitter
twitter icon@FreshPatents

Web & Computing
Cloud Computing
Ecommerce
Search patents
Smartphone patents
Social Media patents
Video patents
Website patents
Web Server
Android patents
Copyright patents
Database patents
Programming patents
Wearable Computing
Webcam patents

Web Companies
Apple patents
Google patents
Adobe patents
Ebay patents
Oracle patents
Yahoo patents

[SEARCH]

Recur patents



      
           
This page is updated frequently with new Recur-related patent applications. Subscribe to the Recur RSS feed to automatically get the update: related Recur RSS feeds. RSS updates for this page: Recur RSS RSS


Classifying samples using clustering

Methods and apparatus for automated web portal and voice system data aggregation

Date/App# patent app List of recent Recur-related patents
07/17/14
20140201277
 System, methods, and computer program products for contextual collaborative updates for recurring meetings patent thumbnailSystem, methods, and computer program products for contextual collaborative updates for recurring meetings
A method of informing a first entity of an activity of a second entity. The activity of the second entity during a period between a first time and a second time is tracked, the period between the first time and the second time being between a time of a first meeting and a time of a second meeting.
07/17/14
20140201208
 Classifying samples using clustering patent thumbnailClassifying samples using clustering
An unlabeled sample is classified using clustering. A set of samples containing labeled and unlabeled samples is established.
07/17/14
20140200928
 Methods and apparatus for automated web portal and voice system data aggregation patent thumbnailMethods and apparatus for automated web portal and voice system data aggregation
Methods and apparatus for automating the process for researching medical claims and/or eligibility, as well as standardizing and analyzing the resulting data are. These methods include automated processes for researching an insurance claim, comprising steps of interactively and recursively querying search fields in a web portal(s) and/or phone system(s), aggregating the information from multiple sources into a standardized format in a database table(s).
07/17/14
20140200659
 Capping bioprosthetic tissue to reduce calcification patent thumbnailCapping bioprosthetic tissue to reduce calcification
A treatment for bioprosthetic tissue used in implants or for assembled bioprosthetic heart valves to reduce in vivo calcification. The method includes applying a calcification mitigant such as a capping agent or an antioxidant to the tissue to specifically inhibit oxidation in tissue.
07/17/14
20140200349
 Manganese containing hydrosilylation catalysts and compositions containing the catalysts patent thumbnailManganese containing hydrosilylation catalysts and compositions containing the catalysts
A composition contains (a) a hydrosilylation reaction catalyst and (b) an aliphatically unsaturated compound having an average, per molecule, of one or more aliphatically unsaturated organic groups capable of undergoing hydrosilylation reaction. The composition is capable of reacting via hydrosilylation reaction to form a reaction product, such as a silane, a gum, a gel, a rubber, or a resin.
07/17/14
20140200348
 Vanadium containing hydrosilylation catalysts and compositions containing the catalysts patent thumbnailVanadium containing hydrosilylation catalysts and compositions containing the catalysts
A composition contains (a) a hydrosilylation reaction catalyst and (b) an aliphatically unsaturated compound having an average, per molecule, of one or more aliphatically unsaturated organic groups capable of undergoing hydrosilylation reaction. The composition capable of reacting via hydrosilylation reaction to form a reaction product, such as a silane, a gum, a gel, a rubber, or a resin.
07/17/14
20140200347
 Rhenium containing hydrosilylation catalysts and compositions containing the catalysts patent thumbnailRhenium containing hydrosilylation catalysts and compositions containing the catalysts
A composition contains (a) a hydrosilylation reaction catalyst and (b) an aliphatically unsaturated compound having an average, per molecule, of one or more aliphatically unsaturated organic groups capable of undergoing hydrosilylation reaction. The composition capable of reacting via hydrosilylation reaction to form a reaction product, such as a silane, a gum, a gel, a rubber, or a resin.
07/17/14
20140200345
 Production method for 2-alkenylamine compound patent thumbnailProduction method for 2-alkenylamine compound
Provided is a method for producing a 2-alkenylamine compound efficiently and at low cost, using a primary or secondary amine compound and a 2-alkenyl compound as the starting materials therefor. The 2-alkenyleamine compound is produced by 2-alkenylating a primary or secondary amine compound, using a specified 2-alkenylating agent and in the presence of a catalyst comprising a complexing agent and a transition metal precursor stabilized by a monovalent anionic five-membered conjugated diene..
07/17/14
20140200313
 Method for preparing dialkyl magnesium compounds by ethylene polymerisation and uses thereof patent thumbnailMethod for preparing dialkyl magnesium compounds by ethylene polymerisation and uses thereof
A process for the preparation by ethylene polymerization of at least one dialkyl magnesium compound of formula r—(ch2—ch2)n—mg—(ch2—ch2)m—r′ in which r and r′, identical or different, represent aryl, benzyl, allyl or alkyl groups and in which the integers n and m, identical or different, represent average —ch2—ch2— chain formation numbers greater than 1, the process including a single stage of mixing the following components: at least one ligand or one ligand precursor, at least one rare earth salt, at least one dialkyl magnesium compound of formula r—mg—r′, and ethylene, in a medium allowing contact between the components of the above mixture.. .
07/17/14
20140200300
 Precursor polyelectrolyte complexes compositions patent thumbnailPrecursor polyelectrolyte complexes compositions
The invention relates to compositions and methods of treatment employing compositions comprising polyelectrolyte complexes. The compositions include a water-soluble first polyelectrolyte bearing a net cationic charge or capable of developing a net cationic charge and a water-soluble second polyelectrolyte bearing a net anionic charge or capable of developing a net anionic charge.
07/17/14
20140200234
Adjuvant chemotherapy for anaplastic gliomas
The present invention involves the use of 2,4-disulfonyl phenyl tert-butyl nitrone (2,4-ds-pbn) in the treatment and prevention of gliomas. The 2,4-ds-pbn may be used alone or combined with other traditional chemo- and radiotherapies and surgery, to treat or prevent glioma occurrence, recurrence, spread, growth, metastasis, or vascularization..
07/17/14
20140200201
Enzymatic production or chemical synthesis and uses for 5,7-dienes and uvb conversion products thereof
Provided herein are steroidal compounds that are androsta-5,7-dienes or a pregna-5,7-dienes and ultraviolet b (uvb) conversion products thereof which includes pharmaceutical compositions of the steroidal compounds as shown in tables 1 and 2. Also provided is a method for producing hydroxylated metabolites of cholecalciferol or ergocalciferol via the p450scc (cyp11a1) or cyp27b1 enzyme systems where the hydroxylase has an activity to hydroxylate position c20 of a secosteroid or its 5,7-dieneal precursor and the hydroxylated metabolites so produced.
07/17/14
20140199915
Novel enhanced filamentous silicone products and processes
Filamentous bodies which are longitudinally extended and other film-like constructions are made by combining liquid siliceous precursors with air and extruding them. Distinct types or grades of fibers, strands, and other film-like constructions are produced which have a multiplicity of useful applications and indications for use owing to their inherent memory, compactability, tensile strength and density.
07/17/14
20140199850
Dry-etch for selective oxidation removal
Methods of selectively etching tungsten oxide relative to tungsten, silicon oxide, silicon nitride and/or titanium nitride are described. The methods include a remote plasma etch formed from a fluorine-containing precursor and/or hydrogen (h2).
07/17/14
20140199800
Luminescent materials that emit light in the visible range or the near infrared range and methods of forming thereof
Luminescent materials and methods of forming such materials are described herein. A method of forming a luminescent material includes: (1) providing a source of a and x, wherein a is selected from at least one of elements of group 1, and x is selected from at least one of elements of group 17; (2) providing a source of b, wherein b is selected from at least one of elements of group 14; (3) subjecting the source of a and x and the source of b to vacuum deposition to form a precursor layer over a substrate; (4) forming an encapsulation layer over the precursor layer to form an assembly of layers; and (5) heating the assembly of layers to a temperature theat to form a luminescent material within the precursor layer..
07/17/14
20140199637
Pattern forming process
A pattern is formed by coating a first chemically amplified positive resist composition comprising a resin comprising recurring units having an acid labile group so that it may turn soluble in alkaline developer upon elimination of the acid labile group, a photoacid generator, and a first organic solvent, onto a processable substrate, prebaking, exposing, peb, and developing in an alkaline developer to form a positive pattern; heating the positive pattern to render it resistant to a second organic solvent used in a second resist composition; coating the second resist composition, prebaking, exposing, peb, and developing in a third organic solvent to form a negative pattern. The positive pattern and the negative pattern are simultaneously formed..
07/17/14
20140199478
Method for producing carbon membrane
Provided is a method of producing a carbon membrane including dipping a porous support in a suspension of a phenolic resin or a suspension of a phenolic resin precursor, drying the resulting support to form a membrane made of the phenolic resin or the phenolic resin precursor, and heat treating and thereby carbonizing the resulting membrane into a carbon membrane.. .
07/17/14
20140199402
Novel compounds for the treatment of inflammatory bowel disease
The present invention relates to a nucleic acid molecule of up to 150 nucleotides comprising consecutively from 5′ to 3′ (a) a first part whose sequence is between 50% and 100% complementary to the sequence aaaagcuggguugagagggcga; (b) a second part capable of forming a loop between the first and the third part; and (c) a third part comprising or consisting of the sequence aaaagcuggguugagagggcga; for use as a medicament. The present invention further relates to a nucleic acid molecule of up to 25 nucleotides comprising the sequence aaaagcuggguugagagggcga, for use as a medicament.
07/17/14
20140199278
Brown adipocyte modification
Methods and therapeutics are provided for treating metabolic disorders by increasing activation of brown adipose tissue. Generally, the methods and therapeutics can increase activation of brown adipose tissue to increase energy expenditure and induce weight loss.
07/17/14
20140197583
Ceramic composition and ceramic injection-molding process
A ceramic composition for an injection-molding process for producing a combustion chamber pressure sensor, in particular for producing an insulation punch of a combustion chamber pressure sensor, includes a ceramic component in a proportion of greater than or equal to 50% by weight and a glass component in a proportion of less than or equal to 50% by weight. The ceramic component includes aluminum oxide.
07/17/14
20140197351
Lithium-ion-conducting materials
Lithium-ion-conducting ceramic materials are disclosed having characteristics of high lithium-ion conductivity at low temperatures, good current efficiency, and stability in water and corrosive media under static and electrochemical conditions. Some general formulas for the lithium-ion-conducting materials include mi1+x+z-δmiiixmivaymivb2-x-ymvzp3-zo12 and mi1+x+4z-δmiiixmivaymivb2-x-y-zp3o12, wherein mi comprises li, na, or mixtures thereof; 0.05<x<0.5, 0.05<y<2, 0≦z<3, and 0≦δ<0.5; miii comprises al, hf, sc, y, la, or mixtures thereof; miva comprises zr, ge, sn, or mixtures thereof; mivb comprises ti; and mv comprises si, ge, sn, or mixtures thereof.
07/17/14
20140196529
System and method for sensing and managing pothole location and pothole characteristics
The present invention provides a system and method for sensing and managing pothole locations and pothole characteristics. An additional aspect of the present invention is to provide a system that may acquire, fuse, and analyze pothole sensing data from several sources to identify potholes in need of maintenance or repair.
07/17/14
20140196222
Conditioning dyeing agent for keratinous fibers
The specification describes an agent for coloring keratinic fibers. The agent includes, in a cosmetically acceptable carrier, at least one oxidation dye precursor, a precursor of a nature-analogous dye, a substantive dye, or combinations thereof.
07/10/14
20140196009
Module structural analysis supporting device and program
A device supporting the structural analysis of a module comprises: a storage means storing at least one module; and a conversion means that converts a prescribed target module among the modules stored by the storage means to a secondary module and stores same in the storage means. The conversion means reads the target module from the storage means and sequentially outputs to the secondary module each sentence written from a prescribed processing start location in the target module to a prescribed processing end location.
07/10/14
20140195692
Robust domain name resolution
A recursive dns nameserver system and related domain name resolution techniques are disclosed. The dns nameservers utilize a local cache having previously retrieved domain name resolution to avoid recursive resolution processes and the attendant dns requests.
07/10/14
20140195433
Upgrading of recurring payment cancellation services
A method of reducing chargebacks due to a cancelled recurring payment, wherein the payment occurs within a card-based financial network, and wherein the network includes a database of unauthorized recurring charges and a defined chargeback procedure. The method generally includes the step of upgrading a recurring payment cancellation services file based on predefined occurrences relating to the identifying of cancelled recurring payments..
07/10/14
20140195200
Smart data sampling and data reconstruction
A computer-based method for characterizing data dependent on at least one variable is described. The method comprises sampling the data in a smart manner by sampling the data in a finite sequence of sampling points, the finite sequence of sampling points being controlled by a magnifying factor for controlling a spacing between elements of the finite sequence of sampling points and being determined such that function values of functions of a family of functions in said finite sequence of sampling points satisfy a recurrence relation.
07/10/14
20140194914
Surgical cutting and sealing instrument with reduced firing force
A surgical instrument is provided that can comprise and end effector including two jaws and a cutting member configured to move between the jaws. In at least one embodiment, one or both of the jaws may be flexible, such that a jaw is configured to flex when gripping tissue.
07/10/14
20140194638
Spirobenzylamine-phosphine, preparation method therefor and use thereof
The present invention relates to a spirobenzylamine-phosphine, preparation method therefor and use thereof. The compound has a structure represented by formula (i), wherein n=0 to 3; r1, r2, r3, r4, r5, r6, r7, r8 and r9 having a value as defined in claim 1.
07/10/14
20140194627
Zinc containing hydrosilylation catalysts and compositions containing the catalysts
A composition contains (a) a hydrosilylation reaction catalyst and (b) an aliphatically unsaturated compound having an average, per molecule, of one or more aliphatically unsaturated organic groups capable of undergoing hydrosilylation reaction. The composition capable of reacting via hydrosilylation reaction to form a reaction product, such as a silane, a gum, a gel, a rubber, or a resin.
07/10/14
20140194620
18f-labeled precursor of pet radioactive medical supplies, and preparation method thereof
The present invention relates to a precursor of positron emission tomography (pet) radioactive medical supplies, a preparation method thereof, and an application thereof, and more specifically, to a precursor having a tetravalent organic salt leaving group, a preparation method, and a method for preparing desired pet radioactive medical supplies in a high radiochemical yield within a short preparation time by introducing 18f using the same through a single step. The precursor having a tetravalent organic salt leaving group of the present invention can simplify the known complex multistep preparation of radioactive medical supplies into a single step, can save production costs because an excessive amount of a phase transfer catalyst is not required, facilitates separation of a compound after reaction, and enables rapid reaction velocity.
07/10/14
20140194603
Method for the production of lignin-containing precursor fibres and also carbon fibres
The invention relates to a method for the production of a precursor for the production of carbon- and activated carbon fibres according to the wet- or air-gap spinning method, in which a solution of lignin and a fibre-forming polymer in a suitable solvent is extruded through the holes of a spinning nozzle into a coagulation bath, the formed thread is stretched and subsequently treated, dried at an elevated temperature and then wound up. The lignin-containing thread is an economical starting material for the production of carbon- and activated carbon fibres..
07/10/14
20140194572
Adhesive composition and easily dismantlable adhesive tape
The present invention provides an easily dismantlable adhesive composition as an adhesive composition containing an acrylic polymer (x) that contains a (meth)acrylate monomer as a main monomer component, and an acid catalyst or an acid generator, in which the acrylic polymer (x) contains a poly(meth)acrylate chain (a) that is formed of repeating units derived from a carboxyl precursor group-containing (meth)acrylate monomer (a), and a number of the repeating units is 10 or greater.. .
07/10/14
20140194546
Easily dismantlable adhesive composition and easily dismantlable adhesive tape
An easily dismantlable adhesive composition containing: an acrylic block polymer having a poly(meth)acrylate chain (a) formed of a carboxyl precursor group-containing (meth)acrylate monomer (a) and a poly(meth)acrylate chain (b) that contains, as monomer components, a (meth)acrylate (b) having an alkyl group having 1 to 14 carbon atoms and a polar group-containing monomer (c); and either an acid catalyst or an acid generator, makes it possible to achieve favorable adhesiveness and dismantlability and suppress stick-slip at the time of dismantlement.. .
07/10/14
20140194509
Hydroxybutyrate ester and medical use thereof
A compound which is 3-hydroxybutyl 3-hydroxybutyrate enantiomerically enriched with respect to (3r)-hydroxybutyl (3r)-hydroxybutyrate of formula (i) is an effective and palatable precursor to the ketone body (3r)-hydroxybutyrate and may therefore be used to treat a condition which is caused by, exacerbated by or associated with elevated plasma levels of free fatty acids in a human or animal subject, for instance a condition where weight loss or weight gain is implicated, or to promote alertness or improve cognitive function, or to treat, prevent or reduce the effects of neurodegeneration, free radical toxicity, hypoxic conditions or hyperglycaemia.. .
07/10/14
20140193983
Apparatuses and methods for depositing sic/sicn films via cross-metathesis reactions with organometallic co-reactants
Disclosed herein are methods of forming sic/sicn film layers on surfaces of semiconductor substrates. The methods may include introducing a silicon-containing film-precursor and an organometallic ligand transfer reagent into a processing chamber, adsorbing the silicon-containing film-precursor, the organometallic ligand transfer reagent, or both onto a surface of a semiconductor substrate under conditions whereby either or both form an adsorption-limited layer, and reacting the silicon-containing film-precursor with the organometallic ligand transfer reagent, after either or both have formed the adsorption-limited layer.
07/10/14
20140193927
Prediction of recurrence for bladder cancer by a protein signature in tissue samples
The present invention pertains to the field of cancer prediction. Specifically, it relates to a method for predicting the risk of recurrence of bladder cancer in a subject after treatment of bladder cancer comprising the steps of determining the amount of at least one biomarker selected from the biomarkers shown in table, and comparing the amount of said at least one biomarker with a reference amount for said at least one biomarker, whereby the risk of recurrence of bladder cancer is to be predicted.
07/10/14
20140193910
Methods for producing pancreatic precursor cells and uses thereof
The present invention is directed to methods for readily propagating somatic pancreatic precursor cells. The methods comprise isolating cells from intact pancreatic samples and enhancing guanine nucleotide (gnp) biosynthesis in cultures comprising these cells, thereby expanding guanine nucleotide pools.
07/10/14
20140193752
Stabilized acid amplifiers
There are disclosed sulfonic acid precursor compositions, as are methods of using these compositions in, for example, photolithography. Other embodiments are also disclosed..
07/10/14
20140193647
Coatings for solar applications
The present invention discloses coating compositions comprising: i) at least one highly absorbing material selected from the group consisting of ruthenium, iridium and osmium compounds, and mixtures thereof; ii) an inorganic glass binder or a precursor thereof; iii) a ceramic filler comprising metal oxides, metal powders and mixtures thereof; and v) a liquid organic vehicle. The invention further discloses methods for preparing these coatings and uses thereof in solar applications..
07/10/14
20140193598
Multilayer adhesive film, in particular for bonding optical sensors
A multilayer pressure sensitive adhesive (psa) film having a first acrylic pressure sensitive adhesive layer and an opposing second acrylic pressure sensitive adhesive layer, wherein the first pressure sensitive adhesive layer has a glass transition temperature tg≧0° c. And a content of a strongly polar acrylate of 7.5 to 15 wt.-% in its precursor, and the second pressure sensitive adhesive layer has a tg≦0° c.
07/10/14
20140193585
Method for modifying probe tip
A method for modifying the probe tip of a microscope, including the following steps of providing a substrate, providing a metal precursor solution with fluoride ion on the substrate, using the probe tip to dip into the metal precursor solution with fluoride ion on the substrate in order to form a nano-metal particle on the probe tip by the reduction reaction of at least one metal ion in the metal precursor solution. As the result, the probe tip having the nano-metal particle thereon can increase the spatial-resolution of the measuring performance of the field sensitive scanning probe microscope due to the great reduction of stray field effects..
07/10/14
20140193579
Combination cvd/ald method and source
The present invention relates generally to methods and apparatus for the controlled growing of material on substrates. According to embodiments of the present invention, a precursor fed is split in to two paths from a precursor source.
07/10/14
20140193578
Splashguard and inlet diffuser for high vacuum, high flow bubbler vessel
The present invention is a bubbler having a diptube inlet ending in a bubble size reducing outlet and at least one baffle disc positioned between the outlet of the diptube and the outlet of the bubbler to provide a narrow annular space between the baffle disc and the wall of the bubbler to prevent liquid droplets from entering the outlet to the bubbler. The bubble size reducing outlet is an elongated cylindrical porous metal frit situated in a sump of approximately the same dimensions.
07/10/14
20140193522
Mixtures for producing chlorine dioxide gas in enclosures and methods of making the same
The present disclosure relates to a mixture for producing chlorine dioxide gas provided in an enclosure comprising an impregnate comprising a chlorine dioxide precursor impregnated in a porous carrier and a proton-generating species, wherein the impregnate and proton-generating species are intermixed to produce a stable mixture and the mixture is provided in an enclosure. The present disclosure also relates to methods for producing chlorine dioxide gas..
07/10/14
20140193499
Bioactive glass composition, its applications and respective preparation methods
The present invention relates to development of bioactive glass/glass-ceramic composition that are able to promote a fast deposition layer of carbonated hydroxyapatite upon immersion in simulated body fluid (sbf) for time periods as short as one hour. Such composition might include fluorides, and a variety of oxides (or their precursor compounds), such as na2o—ag2o—sro—cao—mgo—zno—p2o5—sio2—bi2o3—b2o3—caf2, be prepared by the melt route or by the sol-gel process, with the specific composition and the preparation route selected according to the intended functionalities, which can present controlled biodegradation rate and bactericidal activity.
07/10/14
20140193380
Technologies, methods, and products of small molecule directed tissue and organ regeneration from human pluripotent stem cells
Pluripotent human embryonic stem cells (hescs) hold great potential for restoring tissue and organ function, which has been hindered by inefficiency and instability of generating desired cell types through multi-lineage differentiation. This instant invention is based on the discovery that pluripotent hescs maintained under defined culture conditions can be uniformly converted into a specific lineage by small molecule induction.
07/10/14
20140193364
Tam receptor ligands, metabolites and precursors thereof in the detection and modulation of inflammatory neuropathological disease
The present disclosure relates to the use of tam receptor ligands, metabolites, precursor and binding partners thereof in the field of inflammatory neuropathology. This includes the early diagnosis and monitoring of an inflammatory neuropathology as well as screening for medicaments used in the treatment and prophylaxis of such a condition.
07/10/14
20140191423
Splashguard and inlet diffuser for high vacuum, high flow bubbler vessel
The present invention is a bubbler having a diptube inlet ending in a bubble size reducing outlet and at least one baffle disc positioned between the outlet of the diptube and the outlet of the bubbler to provide a narrow annular space between the baffle disc and the wall of the bubbler to prevent liquid droplets from entering the outlet to the bubbler. The bubble size reducing outlet is an elongated cylindrical porous metal frit situated in a sump of approximately the same dimensions.
07/10/14
20140191406
Manufacturing method for semiconductor package, semiconductor package, and semiconductor device
One aspect of the present invention resides in a manufacturing method for a semiconductor package, including a covering step of forming a covering insulating layer that covers the surface of a semiconductor element, a film-forming step of forming a resin film on the surface of the covering insulating layer, a circuit pattern-forming step of forming a circuit pattern portion including recesses reaching the surfaces of electrodes of the semiconductor element and a circuit groove having a desired shape and a desired depth, a catalyst-depositing step of depositing a plating catalyst or a precursor thereof on the surface of the circuit pattern portion, a film-separating step of separating the resin film from the covering insulating layer, and a plating processing step of forming a circuit electrically connected to the electrodes, by applying electroless plating to the covering insulating layer, from which the resin film is separated.. .
07/10/14
20140191222
Resin composition and display device using the same
The resin composition of the present invention is a resin composition characterized by including (a) a polyimide, a polybenzoxazole, a polyimide precursor or a polybenzoxazole precursor, (b) 1,5-dihydroxynaphthalene, 1,6-dihydroxynaphthalene, 1,7-dihydroxynaphthalene, or 2,3-dihydroxynaphthalene, and (c) a thermal cross-linking agent having a specific structure. By the use of the resin composition of the present invention, it is possible to reduce the transmittance in the visible region of a cured film while maintaining the transmittance of a resin film before curing..
07/10/14
20140191157
Composition for acid gas tolerant removal of mercury from a flue gas
Compositions and method useful for removal of mercury from a flue gas stream with relatively high concentrations of acid gas precursors and/or acid gases. The method includes contacting the flue gas stream with a sorbent composition comprising a sorbent material and a multi-functional agent, where the multi-functional agent includes a compound having a metal of valency 3 or higher.
07/10/14
20140190870
Synergistic h2s scavenger combination of transition metal salts with water-soluble aldehydes and aldehyde precursors
The use of a composition including a transition metal salt and at least one water-soluble aldehyde or water-soluble aldehyde precursor scavenges h2s that is present in aqueous fluids (e.g. Produced water liquid streams), natural gas and in oil and mixtures thereof (e.g.
07/10/14
20140190818
Method for stabilizing carbon-containing fibre and method for producing carbon fibre
The group of inventions pertains to the field of producing high-strength carbon fibres, which can be primarily manufactured from an organic starting material (precursor). A method for stabilizing a carbon-containing fibre (precursor) is claimed, in which the fibre is placed into a gaseous medium and subjected to treatment with microwave radiation as the gaseous medium is heated.
07/10/14
20140190565
Polymer/inorganic multi-layer encapsulation film
This invention relates to a polymer/inorganic multi-layer encapsulation film, and more particularly, to a multi-layer encapsulation film, which includes a plasma polymer thin film layer formed using a cross-shaped precursor having si—o bonding and an inorganic thin film layer, and ensures flexibility and has improved encapsulation.. .
07/10/14
20140190508
Method
A method of removing colour from hair that has been oxidatively dyed, the method comprising the steps of: (a) contacting the hair with a composition comprising a sulfur-containing nucleophile or a precursor thereof; (b) contacting the hair with an acidic composition; and (c) contacting the hair with an oxidising composition; wherein there is no rinsing step between step (a) and step (b).. .
07/10/14
20140190411
Lid assembly for a processing system to facilitate sequential deposition techniques
Embodiments of the invention generally relate to apparatuses for processing substrates. In one embodiment, a substrate processing system is provided and includes a lid having an upper lid surface opposed to a lower lid surface, a plurality of gas inlet passages extending from the upper lid surface to the lower lid surface, a gas manifold disposed on the lid, at least one valve coupled with the gas manifold and configured to control a gas flow through one of the gas inlet passages, wherein the at least one valve is configured to provide an open and close cycle having a time period of less than about 1 second during a gas delivery cycle for enabling an atomic layer deposition process.
07/03/14
20140189387
Staged power distribution control
Various embodiments are directed to restrictions in portable computing device electric power to accommodate reductions in the voltage level of a power source. An apparatus comprises a controller caused to receive configuration data from a main processor circuit specifying a voltage level threshold and selected action to take to reduce electric power to a first component in response to the voltage level falling below the first voltage level threshold, recurringly monitor the voltage level; based on the voltage level falling below the first voltage level threshold, take the first selected action and transmit a signal to the main processor circuit indicating that the voltage level has fallen below the first voltage level threshold and that the first selected action has been taken; transmit the voltage level to the main processor circuit; receive a signal from the main processor circuit to undo the first selected action; and so undo..
07/03/14
20140188777
Methods and systems for identifying a precursor to a failure of a component in a physical system
A computer-implemented system for identifying a precursor to a failure of a particular type of component in a physical system is provided. The physical system includes sensors coupled to the physical system.
07/03/14
20140187792
Condensed polycyclic aromatic compound, aromatic polymer, and method for synthesizing aromatic compound
Provided is a condensed polycyclic aromatic compound that can be used as a precursor for synthesizing a condensed polycyclic aromatic compound having relatively high solubility. Also provided is a method for synthesizing and using such a novel condensed polycyclic aromatic compound.
07/03/14
20140187783
Hafnium containing hydrosilylation catalysts and compositions containing the catalysts
A composition contains (a) a hydrosilylation reaction catalyst and (b) an aliphatically unsaturated compound having an average, per molecule, of one or more aliphatically unsaturated organic groups capable of undergoing hydrosilylation reaction. The composition is capable of reacting via hydrosilylation reaction to form a reaction product, such as a silane, a gum, a gel, a rubber, or a resin.
07/03/14
20140187769
Oxadiazoanthracene compounds for the treatment of diabetes
Wherein a, b, c, r, r1, r2, r3, r4 and r5 are as herein described, and methods of synthesizing precursors to these oxadiazoanthracene derivatives.. .
07/03/14
20140187663
Telechelic macromer, method for producing telechelic macromer and composition containing telechelic macromer
A telechelic macromer is disclosed having (meth)acrylic end-groups and a core. The macromer defined by formula 1 comprises a core y (formulas 2 to 9) that is linked to (meth)acrylic groups by urethane, ester or anhydride bonds and has iodine value ranging from 5 to 75.
07/03/14
20140187018
Methods for reproducible flash layer deposition
A method for reducing the leakage current in dram metal-insulator-metal capacitors includes forming a flash layer between the dielectric layer and the first electrode layer. A method for reducing the leakage current in dram metal-insulator-metal capacitors includes forming a capping layer between the dielectric layer and the second electrode layer.


Popular terms: [SEARCH]



Follow us on Twitter
twitter icon@FreshPatents

###

This listing is a sample listing of patent applications related to Recur for is only meant as a recent sample of applications filed, not a comprehensive history. There may be associated servicemarks and trademarks related to these patents. Please check with patent attorney if you need further assistance or plan to use for business purposes. This patent data is also published to the public by the USPTO and available for free on their website. Note that there may be alternative spellings for Recur with additional patents listed. Browse our RSS directory or Search for other possible listings.
     SHARE
  
         


FreshNews promo



1.497

3048

1 - 1 - 73