FreshPatents.com Logo
Enter keywords:  

Track companies' patents here: Public Companies RSS Feeds | RSS Feed Home Page
Popular terms

[SEARCH]

Follow us on Twitter
twitter icon@FreshPatents

Web & Computing
Cloud Computing
Ecommerce
Search patents
Smartphone patents
Social Media patents
Video patents
Website patents
Web Server
Android patents
Copyright patents
Database patents
Programming patents
Wearable Computing
Webcam patents

Web Companies
Apple patents
Google patents
Adobe patents
Ebay patents
Oracle patents
Yahoo patents

[SEARCH]

Radiation patents



      
           
This page is updated frequently with new Radiation-related patent applications. Subscribe to the Radiation RSS feed to automatically get the update: related Radiation RSS feeds. RSS updates for this page: Radiation RSS RSS


Image-capture apparatus controlling display at photographing time

Emitting light using multiple phosphors

Date/App# patent app List of recent Radiation-related patents
09/25/14
20140288426
 Object information acquiring apparatus patent thumbnailnew patent Object information acquiring apparatus
An object information acquiring apparatus includes a probe configured to irradiate ultrasonic waves to an object, receive ultrasonic echoes, and convert the ultrasonic echoes into electric signals, a scanning unit configured to cause the probe to perform back-and-forth scanning on the object, an ultrasonic control unit configured to control irradiation of ultrasonic waves, a signal processing unit configured to obtain an ultrasonic, and a combining unit configured to combine a plurality of ultrasonic images. The scanning unit causes the probe to perform back-and-forth scanning on the object such that regions subjected to ultrasonic irradiation performed by the probe in forward and backward paths in the back-and-forth scanning overlap with each other.
09/25/14
20140288350
 Flexible applicator for radiation therapy patent thumbnailnew patent Flexible applicator for radiation therapy
Wherein the absorption body is movable with respect to the main body in such a way that the preferred radiation direction can be tilted into a plurality of different positions relative to the main axis of the main body.. .
09/25/14
20140288348
 Radiotherapy treatment device comprising image acquisition device and irradiation device, and radiotherapy method patent thumbnailnew patent Radiotherapy treatment device comprising image acquisition device and irradiation device, and radiotherapy method
A radiotherapy treatment device comprising an image acquisition device, in particular a magnetic resonance device, an irradiation device comprising in particular a linear accelerator, and a patient positioning device having a patient positioning platform, wherein a movement device is provided for jointly moving the image acquisition device and the irradiation device between an irradiation position, in which a radiotherapeutic treatment of a patient located on the patient positioning platform is possible by means of the irradiation device, and an image acquisition position, in which an image acquisition of the patient located on the patient positioning platform is possible by means of the image acquisition device is provided. A radiotherapy method for treating an irradiation target in a patient by means of such a radiotherapy treatment device is also disclosed..
09/25/14
20140287363
 Actinic ray-sensitive or radiation-sensitive resin composition, and, resist film, pattern forming method, electronic device manufacturing method, and electronic device, each using the composition patent thumbnailnew patent Actinic ray-sensitive or radiation-sensitive resin composition, and, resist film, pattern forming method, electronic device manufacturing method, and electronic device, each using the composition
Disclosed are an actinic ray-sensitive or radiation-sensitive resin composition including (a) a compound capable of generating an acid by irradiation of actinic rays or radiation, and (b) a resin of which solubility in an alkali developer increases by being decomposed by the action of an acid, and, a resist film, a pattern forming method, an electronic device manufacturing method, and an electronic device, each using the composition, wherein the actinic ray-sensitive or radiation-sensitive resin composition contains at least one type of a specific compound represented by general formula (a-i) and at least one type of a specific compound represented by general formula (a-ii) as the compound (a).. .
09/25/14
20140287151
 Reaction-based laser marking compositions, systems and methods patent thumbnailnew patent Reaction-based laser marking compositions, systems and methods
An ink formulation comprises a binder and at least one marking component, which comprises at least one metal oxides or oxyanion and at least one oxidizing/reducing agent, which absorbs laser irradiation between wavelengths of 780-10,600 nm, thereby causes the formulation to change color.. .
09/25/14
20140287005
 Photoprotective composition containing an unmodified gelling starch and polyamide particles patent thumbnailnew patent Photoprotective composition containing an unmodified gelling starch and polyamide particles
The present invention relates to a composition intended for protecting the skin and/or hair against ultraviolet radiation, characterized by the fact that it comprises, in a cosmetically acceptable support containing at least one aqueous phase, at least: (a) a photoprotective system capable of screening out uv radiation; (b) at least one gelling starch that is not modified by a chemical or physical process; and (c) polyamide particles, in particular polyamide pa-12 or polyamide pa-6 particles. The present invention also relates to the use of the combination of at least one gelling starch that is not modified by a chemical or physical process and polyamide particles in a composition comprising, in a cosmetically acceptable support comprising at least one aqueous phase, at least one photoprotective system capable of screening out uv radiation, for the purpose of improving the cosmetic properties after application, especially the non-tacky effect, non-greasy effect, non-shiny effect and/or the absence of residual film..
09/25/14
20140286474
 X-ray fluorescence analyzer patent thumbnailnew patent X-ray fluorescence analyzer
An x-ray fluorescence analyzer includes a sample stage having an opening at an x-ray irradiation position, an x-ray source which irradiates a sample placed on the opening with a primary x-ray from below, a detector which detects an x-ray fluorescence generated from the sample, a transparent drop prevention plate supported to be advanced and retracted immediately below the opening, a drive mechanism which advances and retracts the drop prevention plate, an observation camera which observes the drop prevention plate positioned immediately below the opening, and an operation unit which processes an image of the drop prevention plate which is captured by the observation camera. The operation unit detects a foreign matter on the drop prevention plate based on an image difference between images before and after the drive mechanism moves or vibrates the drop prevention plate within an observation range of the observation camera..
09/25/14
20140286038
 Light source system patent thumbnailnew patent Light source system
The light source system includes a plurality of light source modules configured to respectively emit light source lights having optical characteristics different from each other, and an irradiation module to which the light source modules are mechanically and detachably attached. The irradiation module includes a first light guide member, a second light guide member, and a first light conversion unit.
09/25/14
20140286036
 Emitting light using multiple phosphors patent thumbnailnew patent Emitting light using multiple phosphors
A light emitting apparatus includes a light emitting device, fixedly situated at a first position, to emit light at a wavelength, a first phosphor, fixedly situated at a second position, to radiate light with a first spectral characteristic out of the light emitting apparatus in response to irradiation by the light at the wavelength, and a second phosphor, fixedly situated at a third position, to radiate light with a second spectral characteristic out of the light emitting apparatus in response to irradiation by the light at the wavelength. An optical coupling mechanism is included to optically couple the light emitting device to the first phosphor and to optically decouple the light emitting device from the second phosphor in a first operating mode, and optically couple the light emitting device to the second phosphor in a second operating mode..
09/25/14
20140286009
 Modular solid state electronic display panels with electromagnetic radiation shielding patent thumbnailnew patent Modular solid state electronic display panels with electromagnetic radiation shielding
A display module having electromagnetic interference shielding is disclosed. The display module has a mask circuit board disposed immediately above a first circuit board.
09/25/14
20140285772
new patent Light source device and display device
There is provided a light source device including a first light source configured to emit light in a first wavelength region, a second light source configured to emit light in a second wavelength region different from the first wavelength region, a wavelength conversion unit including a fluorescent material and configured to emit fluorescent emission light in a different wavelength region upon irradiation with the light in the first wavelength region, and a combining unit that has wavelength selectivity to a specific wavelength region corresponding to the second wavelength region and combines the light in the first wavelength region from the first light source, the light in the second wavelength region from the second light source, and the fluorescent emission light which are incident on the combining unit with one another.. .
09/25/14
20140285699
new patent Image-capture apparatus controlling display at photographing time
An image-capture unit 22 of an image-capture apparatus 1 captures an image of a subject. A display unit 21 can be disposed in a range where emission light reaches the subject whose image is captured by the image-capture unit 22 and displays the image using the emission light.
09/25/14
20140285541
new patent Light irradiation device
A light irradiation device to display an image by light irradiation prevents easy perception of distortion occurring in the displayed image due to vibration of the device or movement of viewpoint. A random number is generated, and the refresh rate of the displayed image is distributed at random in correspondence with the random number.
09/25/14
20140284775
new patent Semiconductor device and method for manufacturing the same
According to one embodiment, there is disclosed a semiconductor device which has a wiring substrate, a semiconductor element mounted on the wiring substrate, a molding resin which seals the semiconductor element, and a shield layer provided on the molding resin, wherein the molding resin has a marking portion by laser irradiation on a surface, and the shield layer is provided on the molding resin having the marking portion.. .
09/25/14
20140284503
new patent Radiation shielding structures
Radiation shielding structures comprising bulk-solidifying amorphous alloys and methods of making radiation shielding structures and components in near-to-net shaped forms are provided.. .
09/25/14
20140284497
new patent Spectral luminescence standard for the near infrared region
A spectral luminescence standard has bismuth in a light-transmissive inorganic matrix material and emits light in the near infrared region upon irradiation with excitation light. The bismuth acts as a luminescence emitter in the near infrared region.
09/25/14
20140284307
new patent Focused ion beam system, sample processing method using the same, and sample processing program using focused ion beam
A focused ion beam system includes a focused ion beam irradiation mechanism which irradiates a sample, on which a protective film is formed, with a focused ion beam from above the sample, a processing control unit which performs a removal process on both sides of a region to be a thin piece portion of the sample by the focused ion beam and sequentially forms observation surfaces parallel to an irradiation direction of the focused ion beam so as to achieve the thin piece portion, and an observation surface image generation unit which generates an observation surface image. The processing control unit terminates the removal process when a height of the protective film in the irradiation direction of the focused ion beam becomes a predetermined threshold value or less in the observation surface image..
09/25/14
20140283385
new patent X-ray device, x-ray irradiation method, and manufacturing method for structure
Provided is an x-ray device capable of suppressing reduction in detection precision. The x-ray device irradiates x-rays on an object and detects x-rays that pass through the object.
09/18/14
20140279725
Radiation therapy planing using integrated model
System and method for automatically generate therapy plan parameters by use of an integrate model with extended applicable regions. The integrated model integrates multiple predictive models from which a suitable predictive model can be selected automatically to perform prediction for a new patient case.
09/18/14
20140277032
Method and apparatus for making ultrasonic irradiation plan, and ultrasonic irradiation method
A method and related apparatus are provided for making an ultrasonic irradiation plan include generating a 3d organ model from an input image, generating irradiation information about a unit treatment volume based on at least one of a movement and a deformation of an organ in the 3d organ model, simulating irradiation of ultrasound for virtual treatment by using the generated irradiation information, and making an ultrasonic irradiation plan based on the simulation. Additionally, a method is provided for determining if such an ultrasonic irradiation plan is applicable, and if so carrying it out by emitting appropriate ultrasonic radiation..
09/18/14
20140276690
Controller to select optical channel parameters in a catheter
A system can include a microprocessor executable controller configured, based on one or more of total fiber active area of a laser catheter, imaging information regarding the target and/or non-target endovascular structure(s), target endovascular structure characterization information, current location and/or orientation of a distal tip of the laser catheter, and area of contact of the distal tip with the target and/or non-target endovascular structure to select at least one of a fiber active area for each optical channel, a number of optical channels, a configuration of fibers in an optical channel, an optical channel to be irradiated, and an ordering of optical channel irradiation.. .
09/18/14
20140275984
Device and method for targeted radiation therapy
Described here are temporary devices for placement into tissue cavities at the time of a surgical procedure. In addition to marking the tissue cavity for radiation therapy, the devices are capable of draining fluid from the cavity.
09/18/14
20140275963
Systems and methods for radiotherapy with magnetic resonance imaging
Systems and methods for delivery of radiotherapy in conjunction with magnetic resonance imaging in which various conductors, shields and shims may be used to solve issues occurring when radiation therapy equipment is placed in the vicinity of an magnetic resonance imaging system.. .
09/18/14
20140275962
Methods and systems using magnetic resonance and ultrasound for tracking anatomical targets for radiation therapy guidance
Methods and systems using magnetic resonance and ultrasound for tracking anatomical targets for radiation therapy guidance are provided. One system includes a patient transport configured to move a patient between and into a magnetic resonance (mr) system and a radiation therapy (rt) system and an ultrasound transducer coupled to the patient transport, wherein the ultrasound transducer is configured to acquire four-dimensional (4d) ultrasound images concurrently with one of an mr acquisition or an rt radiation therapy session.
09/18/14
20140275715
Dosimetrically customizable brachytherapy carriers and methods thereof in the treatment of tumors
Brachytherapy radioisotope carrier systems and methodology for providing real-time customized brachytherapy treatment to subjects with tumors difficult to control using conventional radiation therapy techniques. The invention generally relates to devices, methods and kits for providing customized radionuclide treatments, to help cure, slow progression or regrowth, or ameliorate the symptoms associated with tumors..
09/18/14
20140275712
Radiation treatment sheet devices and methods
Radiation therapy devices, systems and methods are in general sheet-like form, are characterized by flexibility, and include at least one spacer that can be a balloon or bubble that assists in placement of radio therapeutic members at desired treatment locations along or around a limb, within an existing body cavity, or at a site that was formed under a patient's skin for treatment purposes. Sarcoma treatment is particularly conducive to treatment by these devices, systems and methods.
09/18/14
20140275710
Radiation therapy treatment plan improvement through use of knowledge base
A method for determining a radiation therapy dose distribution starts with selecting and downloading a treatment type from a database. Then an organ at risk (oar) distance to target map is determined, wherein the oar distance to target map comprises distances to a target organ for respective portions of at least one oar, and wherein the oar distances are determined from at least one segmented patient organ image.
09/18/14
20140275708
Optionally transportable machine for use in intraoperative electron radiation therapy
An electron therapy unit for delivering therapeutic electrons to a patient during an operation that is made up of a movable and stowable beam head that may be connected permanently or temporarily to either a base cabinet or a fixed structure using one or more optionally pivotable arms is provided. In an exemplary embodiment, the inventive electron therapy unit is a mobile unit suitable for in-hospital use or for shared use between hospitals or clinics.
09/18/14
20140275707
Intra-fraction motion management system and method
The present invention relates to the field of radiation therapy. In particular, the invention concerns systems and methods for monitoring intra-fraction motions of patients in connection with treatment cancer in radiation therapy system.
09/18/14
20140275704
Methods and system for breathing-synchronized, target-tracking radiation therapy
Preparing a plan to synchronize radiation delivery to a target in a patient with patient breathing phase and amplitude as the independent variable comprising (a) obtaining simultaneous data on patient breathing and target shape and location, (b) correlating the data and optimizing the correlation, (c) establishing optimal parameters of radiation delivery for each breathing phase/amplitude or for each target shape/location; and (d) synchronizing radiation delivery to a target in a patient with patient breathing comprising (a) positioning the patient, (b) monitoring actual breathing or the shape/location of the target, and (c) while monitoring, delivering radiation to the target according to a plan; and a system for controlling radiation delivery by a device to a target in a patient comprising (i) a processor, which receives and processes data on breathing or the shape/location of the target, and (ii) a controller, which controls radiation delivery to the target according to a plan, which synchronizes radiation delivery to the target with breathing data or the shape/location of the target.. .
09/18/14
20140275703
Method and system for dose determination of radiation therapy
Methods for performing dose determination and cost function gradients in a radiation therapy are disclosed, which include: discretizing a volume-of-interest (voi) into a set of voxels; identifying a set of beamlets which deposit dose contributions of radiation to the voi, and each beamlet has a weight factor; transforming the dose contributions into a first domain, and transforming the weight factors into a second domain orthogonal to the first domain; calculate the local derivatives of a cost function of dose and cost function gradients with respect to the weights of the beamlets.. .
09/18/14
20140275699
Compact proton therapy system with energy selection onboard a rotatable gantry
Systems and apparatuses for providing particle beams for radiation therapy with a compact design and suitable to a single treatment room. The radiation system comprises a stationary cyclotron coupled to a rotating gantry assembly through a beam line assembly.
09/18/14
20140275698
Intra-fraction motion management system and method
The present invention relates to the field of radiation therapy. In particular, the invention concerns systems and methods for monitoring intra-fraction motions of patients in connection with treatment cancer in radiation therapy system.
09/18/14
20140275449
Interfacial processes for preparing photoactive additives
Different interfacial processes for producing photoactive additives are disclosed. Generally, the photoactive additives are cross-linkable polycarbonate resins formed from a dihydroxybenzophenone, a first linker moiety, a diol chain extender, and an end-capping agent.
09/18/14
20140275320
Methods for making elastomers, elastomer compositions and related elastomers
Methods of producing an elastomer are disclosed that include (i) applying a composition that includes a urethane (meth)acrylate to a substrate at a thickness of at least 10 mils; (ii) exposing the composition ultraviolet radiation to produce a cured film; and (iii) removing the film from the substrate. Related compositions are also disclosed..
09/18/14
20140275214
Custirsen treatment with reduced toxicity
The present invention provides a method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefit in the treatment of cancer, comprising administering an anti-clusterin oligonucleotide having the sequence cagcagcagagtcttcatcat (seq. Id no.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-o-methoxyethyl modifications, has nucleotides 5-17 which are 2′ deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, to a human subject in need of treatment for the cancer, which human subject also receives at least one chemotherapeutic agent, hormone ablation therapy, or radiation therapy, wherein the anti-clusterin oligonucleotide is administered at least 3 times during a 5 to 9 day period, wherein at least 1 of the administrations is at a dose other than 640 mg.
09/18/14
20140272468
Photochromic articles that include photochromic-dichroic materials
The present invention relates to photochromic articles that include a substrate and at least one photochromic material that is adapted to change from an unactivated form to an activated form by exposure to radiation substantially in the wavelength range from 380 to 450 nanometers when measured over a range of from 380 to 700 nanometers. The photochromic article is also adapted to retain at least 12 percent of the delta od measured in the outdoor test when tested in the behind the windshield test.
09/18/14
20140272465
Method of heat treatment of silver layers
The subject of the invention is a process for obtaining a material comprising a substrate coated on at least one portion of at least one of its faces with a stack of thin layers comprising at least one silver layer, said process comprising a step of depositing said stack then a heat treatment step, said heat treatment being carried out by irradiating at least one portion of the surface of said stack using at least one incoherent light source for an irradiation time ranging from 0.1 millisecond to 100 seconds, so that the sheet resistance and/or the emissivity of said stack is reduced by at least 5% in relative terms, the or each silver layer remaining continuous at the end of the treatment.. .
09/18/14
20140272438
Low gloss coatings
A low-gloss coating composition is disclosed. The coating composition comprises a unique blend of particles, including untreated silica and organic treated silica and wax treated silica.
09/18/14
20140272189
Microwave driven diffusion of dielectric nano- and micro-particles into organic polymers
A method of doping a substrate with dielectric dopant particles. The substrate, comprising an organic polymer, is exposed to a first layer comprising a first plurality of dielectric dopant particles.
09/18/14
20140271638
Methods using 3-(4-amino-1-oxo-1,3-dihydro-isoindol-2-yl)-piperidine-2,6-dione for treatment of mantle cell lymphomas
Methods of treating, preventing or managing mantle cell lymphomas are disclosed. The methods encompass the administration of an immunomodulatory compound of the invention known as revlimid® or lenalidomide.
09/18/14
20140271496
Dental material and method
A dental material composed of hydrophilic polycaprolactone formed by the process of exposing a hydrophobic caprolactone to ionizing irradiation from a radiation source selected from the group consisting of an electron acceleration (e beam), gamma ii, cobolt, x-ray or a source of uv radiation to form a cross linked polycaprolactone composition consisting of two distinct phases one of which is soluble and the other non-soluble, and adjusting the duration of ionizing radiation and/or the intensity of the radiation to cause the concentration of the soluble phase to be above at least about 65% by weight of the cured polymeric composition whereby the hydrophobic caprolactone becomes hydrophilic.. .
09/18/14
20140270734
Light irradiation type heat treatment apparatus and heat treatment method
Four wafer pins are fixed in a chamber and spaced at intervals of 90 degrees. Four support pins are provided in a wafer pocket of a susceptor and spaced at intervals of 90 degrees.
09/18/14
20140270076
Rodent ionizing radiation treatment device
The present application relates to rodent radiation device that enables simultaneous radiation treatment of a plurality of small animals such as mice with localized radiation therapy. The device can provide clinically-relevant homogeneous radiation dosing and scheduling to a plurality of small animals or other in vivo cancer models simultaneously.
09/18/14
20140270035
Process and apparatus for condensation repressing isotope separation by laser activation
Isotope enrichment by laser activation wherein a multi-isotopic element q, like uranium, silicon, carbon is incorporated into gaseous qfn, qf6, qf4, qomfn, etc and diluted in gas g like he, n2, ar, xe, sf6 or other inert gas; and wherein that mixture is cooled by adiabatic expansion or other means encouraging formation of dimers qf6:g in a supersonic super-cooled free jet; and wherein that jet is exposed to laser photons at wavelengths that selectively excite predetermined molecules iqf6 to iqf6*, thereby inducing rapid vt conversions and dissociations of iqf6*:g→iqf6+g+kt, while leaving non-excited dimers jqf6:g intact; and wherein a skimmer separates the supersonic free-jet core stream containing heavier jqf6:g dimers from lighter core-escaped iqf6-enriched rim gases. Particularly an advanced technique is disclosed to enrich iuf6 by free jet expansion and isotope-selective dimerization suppression, utilizing a molecular co laser and intra-cavity uf6 irradiation with laser lines overlapping predetermined iuf6 absorptions; and providing multiple free jet separator units irradiated by one laser beam, thereby enhancing process economics..
09/18/14
20140268520
Method of manufacturing member with sealing material layer, member with sealing material layer, and manufacturing apparatus
A method of manufacturing a member with a sealing material layer has a substrate preparation step, a coating step, a firing step, and a pre-process step. In the substrate preparation step, a substrate having a frame-shaped sealing region is prepared.
09/18/14
20140268254
Light irradiation system, image scanning apparatus, and image forming apparatus
A light irradiation system for irradiating light to an irradiation area extending in a main scanning direction of a document face when placed on an image scanning apparatus includes a light source; a light guiding member to guide light emitted from the light source; and a reflector to reflect a part of light exiting from the light guiding member to the document face. The irradiation area is irradiated by the reflection light reflected by the reflector and a direct light exiting from the light guiding member without reflection at the reflector.
09/18/14
20140268122
Defect inspection method and defect inspection device
A defect inspection method and device for irradiating a linear region on a surface-patterned sample mounted on a planarly movable table, with illumination light from an inclined direction relative to a direction of a line normal to the sample, next detecting in each of a plurality of directions an image of the light scattered from the sample irradiated with the illumination light, then processing signals obtained by the detection of the images of the scattered light, and thereby detecting a defect present on the sample; wherein the step of detecting the scattered light image in the plural directions is performed through elliptical lenses in which elevation angles of the optical axes thereof are different from each other, within one plane perpendicular to a plane formed by the normal to the surface of the table on which to mount the sample and the longitudinal direction of the linear region irradiated with the irradiation light, the elliptical lenses being formed of circular lenses having left and right portions thereof cut.. .
09/18/14
20140267972
Liquid crystal display device
A liquid crystal display device includes a liquid crystal display panel and a backlight device. The backlight device includes: a light guide for emitting a planar light beam, a first optical sheet disposed on a back side of the light guide, and an optical sheet group disposed on an irradiation-surface side of the light guide and including a plurality of optical sheets arranged in stacked relation.
09/18/14
20140267697
Method and apparatus for real-time mechanical and dosimetric quality assurance measurements in radiation therapy
A method and device for real-time mechanical and dosimetric quality assurance measurements in radiation therapy provides a unified measurement of mechanical motion and radiation components of the machine. The device includes an imaging surface for receiving multiple energy sources.
09/18/14
20140267657
Endoscope apparatus
An endoscope apparatus includes: an image pickup portion that, with respect to return light including a plurality of wavelength band components that is generated accompanying irradiation of illuminating light onto an object, receives the return light with a plurality of different spectral sensitivities and generates an image pickup signal for each of the spectral sensitivities; a correction portion that, based on a spectral distribution of the return light and spectral sensitivity characteristics of the image pickup portion, sets a correction coefficient so that spectral distributions for each of the plurality of wavelength band components included in the image pickup signals become a similar shape to each other; and a calculation portion that, based on the correction coefficient, performs a calculation that separates image pickup signals into each wavelength band component among the plurality of wavelength band components included in the return light.. .


Popular terms: [SEARCH]



Follow us on Twitter
twitter icon@FreshPatents

###

This listing is a sample listing of patent applications related to Radiation for is only meant as a recent sample of applications filed, not a comprehensive history. There may be associated servicemarks and trademarks related to these patents. Please check with patent attorney if you need further assistance or plan to use for business purposes. This patent data is also published to the public by the USPTO and available for free on their website. Note that there may be alternative spellings for Radiation with additional patents listed. Browse our RSS directory or Search for other possible listings.
     SHARE
  
         


FreshNews promo



0.5323

3634

72 - 0 - 73