Follow us on Twitter
twitter icon@FreshPatents


Proteins patents

      

This page is updated frequently with new Proteins-related patent applications.




 Protein functional and sub-cellular annotation in a proteome patent thumbnailnew patent Protein functional and sub-cellular annotation in a proteome
Techniques are disclosed for identifying the likely functionality and sub-cellular localization of individual proteins by first creating a protein-protein interaction network where protein pairs are created from data available from databases and experimental results, and by guessing potential interacting protein pairs where no data exists. Inside each protein pair, mutual likely functionality and localization annotations are made using the known functionalities and localization of the two proteins.
Insybio Ltd


 Algorithm for constructing hypothetical evolutionary trees using common mutations similarity matrices patent thumbnailnew patent Algorithm for constructing hypothetical evolutionary trees using common mutations similarity matrices
The present invention permits constructing hypothetical evolutionary trees for a set of genetically related dna strings or a set of proteins within a protein family. The main novelty of the invention compared to other hypothetical evolutionary tree construction methods is the use of a common mutations similarity matrix..

 Detection of shed cd31, diagnosis of atherothrombosis and autoimmune disorders, and methods for analyzing signaling pathways patent thumbnailnew patent Detection of shed cd31, diagnosis of atherothrombosis and autoimmune disorders, and methods for analyzing signaling pathways
The present invention stems from the finding that the extracellular domain of cd31 proteins present on blood leukocytes is shed and released in the circulation as a soluble form of cd31. A method for detecting shed cd31 is further disclosed.
Institut National De La Sante Et De La Recherche Medicale (inserm)


 Methods and systems for cell state quantification patent thumbnailnew patent Methods and systems for cell state quantification
Systems, methods, libraries, kits, and computer software tools are provided for designing and producing engineered cells. Such engineered cells can be used for cell state quantification, such as genome, transcriptome and/or proteome quantification.
Ginkgo Bioworks, Inc.


 Novel lectins and applications for the detection of pathological state markers patent thumbnailnew patent Novel lectins and applications for the detection of pathological state markers
Multimenic lectins having a β-propeller architecture, formed from monomer modules of approximately 30 to 60 amino acids, in which the binding sites to the glycans are situated on a given side of the proteins and the o-terminus and n-terminus ends of the peptide chains on the other side of the proteins, characterized in that they are formed from 4 to 7 monomer modules, a single, or a plurality of, or all of the adjacent modules being linked to one another by the linkers linking the n-terminus end of one module to the c-terminus end of the adjacent module.. .
Universite Joseph Fourier


 Method for detecting carcinogenesis in the uterine cervix patent thumbnailnew patent Method for detecting carcinogenesis in the uterine cervix
The invention concerns some methods for diagnosing cancer of the uterine cervix (or extra-uterine) which integrate or surrogate the field of action of cytology with that of molecular biology, and provide a system for diagnosis, prognosis and management of hpv-induced cervical lesions (or extra-uterine) which exploit, in particular, the analytical methods of western blot and sandwich elisa in order to detect those cases where the transformation towards a neoplastic lesion has become irreversible. The methods consist in detecting, in samples of cells taken from the squamous-columnar junction of the uterine cervix of a patient under examination, the proteins encoded by viral oncogenes e6 and e7 and those encoded by the tumor suppressor genes of the host cell p53 and prb, and in detecting by western blot and/or by sandwich elisa the possible interaction between proteins e6 and p53, and between proteins e7 and prb, as an index of irreversible transformation towards a neoplastic lesion..

 Pca3, pca3 genes, and methods of use patent thumbnailnew patent Pca3, pca3 genes, and methods of use
The present invention relates, in general, to a prostate-specific antigen, pca3. In particular, the present invention relates to nucleic acid molecules coding for the pca3 protein; purified pca3 proteins and polypeptides; recombinant nucleic acid molecules; cells containing the recombinant nucleic acid molecules; antibodies having binding affinity specifically to pca3 proteins and polypeptides; hybridomas containing the antibodies; nucleic acid probes for the detection of nucleic acids encoding pca3 proteins; a method of detecting nucleic acids encoding pca3 proteins or polypeptides in a sample; kits containing nucleic acid probes or antibodies; bioassays using the nucleic acid sequence, protein or antibodies of this invention to diagnose, assess, or prognose a mammal afflicted with prostate cancer; therapeutic uses; and methods of preventing prostate cancer in an animal..
The Johns Hopkins University


 Individualized cancer therapy patent thumbnailnew patent Individualized cancer therapy
In certain preferred embodiments, the invention provides methods for treating cancer, which comprise (a) obtaining a specimen of cancer tissue from a patient; (b) obtaining a specimen of normal tissue in the proximity of the cancer tissue from such patient; (c) extracting total protein and rna from the cancer tissue and normal tissue; (d) obtaining a protein expression profile of the cancer tissue and normal tissue using 2d dige and mass spectrometry; (e) identifying proteins that are expressed in such cancer tissue at significantly different levels than in the normal tissue; (f) obtaining a gene expression profile of the cancer tissue and normal tissue using microarray technology and comparing the results thereof to the protein expression profile; (g) prioritizing over-expressed proteins by assessing the connectivity thereof to other cancer-related or stimulatory proteins; (h) designing an appropriate rna interference expression cassette to, directly or indirectly, modulate the expression of genes encoding such prioritized proteins; (i) incorporating said cassette into an appropriate delivery vehicle; and (j) providing the patient with an effective amount of the delivery vehicle to directly or indirectly, modify the expression (i.e., production) of such proteins.. .
Gradalis, Inc.


 Systems and methods for treating patients having a genetic predisposition to develop prostate cancer patent thumbnailnew patent Systems and methods for treating patients having a genetic predisposition to develop prostate cancer
Systems and methods for mitigating prostate cancer development are provided. Peripheral blood cells may be evaluated for the presence or quantity of gamma-h2ax foci, and/or for gene alterations encoding a protein with impaired or lack of function, for example, because the encoded protein is truncated, and correlating with prostate cancer development.
Institute For Cancer Research D/b/a The Research Institute Of Fox Chase Cancer Center


 Methods and kits for treating and classifying individuals patent thumbnailnew patent Methods and kits for treating and classifying individuals
The present disclosure provides methods and kits for treating and classifying individuals at risk of or suffering from a neurological and/or mitochondrial dysfunction or disorder. In general, the individuals are treated and/or classified based on the presence of a loss-of-function mutation in nuclear dna encoding one or more proteins selected from the group consisting of aldh1l1, aldh1l2, folr1, fpgs, gcsh, gldc, mthfd1, mthfd1l, mthfd2, mthfd2l, mthfs, mtrr, shmt1, shmt2 and slc25a32.
Courtagen Life Sciences, Inc.


new patent

Methods and compositions for genomic target enrichment and selective dna sequencing

It has been established that one or more large double stranded dna fragments (each 2,000 to 40,000 base pairs in size) can be captured and isolated from genomic dna fragments using sequence specific pna hybridization probes. Compositions and methods for enrichment of a multiplicity of long dna sequences selected from the genome of any eukaryote are provided.
Petaomics, Inc.

new patent

Purification of secreted polysaccharides from s. agalactiae

The invention relates to bacterial mutants, particularly from streptococcus agalactiae, that secrete capsular polysaccharide and methods of purifying the secreted bacterial capsular polysaccharides from culture medium. The extracted polysaccharides are useful for producing vaccines comprising the polysaccharides alone or conjugated to proteins..
Glaxosmithkline Biologicals Sa

new patent

Crispr-based genome modification and regulation

The present invention provides rna-guided endonucleases, which are engineered for expression in eukaryotic cells or embryos, and methods of using the rna-guided endonuclease for targeted genome modification in in eukaryotic cells or embryos. Also provided are fusion proteins, wherein each fusion protein comprises a crispr/cas-like protein or fragment thereof and an effector domain.
Sigma-aldrich Co. Llc

new patent

Synthetic chloroplast transit peptides

This disclosure concerns compositions and methods for targeting peptides, polypeptides, and proteins to plastids of plastid-containing cells. In some embodiments, the disclosure concerns chloroplast transit peptides that may direct a polypeptide to a plastid, and nucleic acid molecules encoding the same.
Dow Agrosciences Llc

new patent

Binding-induced dna nanomachines

The invention provides a binding-induced dna nanomachine that can be activated by proteins and nucleic acids. This new type of nanomachine hamesses specific target binding to trigger assembly of separate dna components that are otherwise unable to spontaneously assemble.
The Governors Of The University Of Alberta

new patent

Fluorescent two-hybrid (f2h) assay for direct visualization of protein interactions in living cells

The present invention relates to a method for detecting protein-protein interactions by assessing interaction in a eukaryotic cell of a first fusion protein that specifically binds to gfp and accumulates at distinct sites in the nucleus of the cell or interacts with structures accumulated at distinct sites in the nucleus of the cell; a second fusion protein comprising gfp and a bait (poly)peptide; and a third fusion protein comprising a fluorescent (poly)peptide having an excitation and/or emission wavelength that differs from that of gfp and a prey (poly)peptide. The emissions from the fluorescent parts of the fusion proteins are observed.
Ludwig-maximilians-universitat Munchen

new patent

Medium containing uridine and n-acetyl-d-mannosamine

Provided are a novel medium for expressing glycoproteins by culturing cells and a method for producing glycoproteins by culturing cells in said medium. Further provided are a medium comprising uridine and n-acethyl-d-mannosamine for the use of expression of a glycoprotein by culturing cells and a method for producing glycoproteins by culturing cells in said medium..
Jcr Pharmaceuticals Co., Ltd.

new patent

Sequencing-directed selection of tumor theranostics

The present disclosure relates to therapies for the treatment of tumor, autoimmune diseases, or other diseases. In some embodiments, the present disclosure can relate to subject-specific selection of humanized antibodies targeting clonal lineage specific marker proteins..
Affigen, Inc.

new patent

Anti-b7-h3 antibodies and diagnostic uses thereof

Provided herein are b7-h3 antibodies, fragments of such antibodies, and compositions comprising the same. The antibodies, antibody fragments and compositions are useful in a number of analytical methods, including immunohistochemical and immunocytochemical detection and analysis of b7-h3.
Spring Bioscience Corporation

new patent

Anti-activin a antibodies and uses thereof

The disclosure provides compositions and methods relating to or derived from anti-activin a binding proteins, including antibodies. In particular embodiments, the disclosure provides fully human, humanized, and chimeric anti-activin a antibodies that bind human activin a, activin a-binding fragments and derivatives of such antibodies, and activin a-binding polypeptides comprising such fragments.
Amgen Inc.

new patent

Compositions and methods for growth factor modulation

Provided herein are proteins, antibodies, assays and methods useful for modulating growth factor levels and/or activities. In some embodiments, such growth factors are members of the tgf-β superfamily of proteins..
Scholar Rock, Inc.

new patent

Novel anti-malignant tumor agent

The present invention provides an antitumor agent having high safety, which is a molecular target drug against malignant tumors. An anti-malignant tumor agent characterized by containing, as an active ingredient, a substance targeting ribosomal proteins shows increased expression in malignant tumor cells.
National University Corporation Okayama University

new patent

Recombinant glycosylated eculizumab and eculizumab variants

The present disclosure relates to, inter alia, a recombinant eculizumab protein or a recombinant eculizumab variant protein having specific glycosylation patterns. The present disclosure relates to, inter alia, a recombinant eculizumab protein or a recombinant eculizumab variant protein made from cho cells.
Alexion Pharmaceuticals, Inc.

new patent

Mrka polypeptides, antibodies, and uses thereof

The present disclosure provides mrka binding proteins, e.g., antibodies or antigen binding fragments thereof that bind to mrka and induce opsonophagocytic killing of klebsiella (e.g., klebsiella pneumoniae). The present disclosure also provides methods of reducing klebsiella (e.g., klebsiella pneumoniae) or treating or preventing klebsiella (e.g., klebsiella pneumoniae) infection in a subject comprising administering mrka binding proteins, e.g., antibodies or antigen-binding fragments thereof, mrka polypeptides, immunogenic fragments thereof, or polynucleotides encoding mrka or immunogenic fragments thereof to the subject..
Medimmune, Llc

new patent

Method for preparing human plasma proteins

The invention relates to a method for preparing plasma protein concentrate from blood plasma by means of multicolumn chromatography.. .
Laboratoire Francais Du Fractionnement Et Des Biotechnologies

new patent

Robust antibody purification

The present invention refers to a method for the separation of host cell proteins (hcps), antibody fragments and low molecular weight substances from solutions containing antibodies.. .
Merck Patent Gmbh

new patent

Factor viii chimeric proteins and uses thereof

The present invention provides a chimeric protein comprising a first polypeptide which comprises a fviii protein and a first ig constant region or a portion thereof and a second polypeptide which comprises a vwf protein comprising the d′ domain and d3 domain of vwf, a xten sequence having less than 288 amino acids in length, and a second ig constant region or a portion thereof, wherein the first polypeptide and the second polypeptide are associated with each other. The invention also includes nucleotides, vectors, host cells, methods of using the chimeric proteins..
Biogen Ma Inc.

new patent

Cd44 binding peptides

The present invention relates to a protein which binds to the domain encoded by exon 9 of human cd44 (cd44ex9), to fusion proteins and conjugates of said protein and especially to nanoparticles conjugated to said protein. The invention further relates to a method of production for the protein and the respective conjugated nanoparticles and the use of the protein of the invention for treatment and diagnosis of cancer diseases..
Exchange Imaging Technologies Gmbh

new patent

Compositions of gm-csf and interleukin fusions for immune modulation and uses related thereto

This disclosure relates to recombinant proteins comprising a gm-csf sequence and an interleukin sequence and nucleic acids related thereto. In certain embodiments, the disclosure relates to recombinant proteins comprises n-terminal sequences that are the result of improved production techniques and uses for treating or preventing autoimmune diseases such as multiple sclerosis and cancer..
Children's Healthcare Of Atlanta, Inc.

new patent

Gitrl fusion proteins and uses thereof

The disclosure provides gitrl fusion polypeptide subunits comprising an igg fc domain, a trimerization domain, and the receptor binding domain of gitr ligand, where the fusion polypeptide subunits can self-assemble into hexameric proteins. Also provided are methods of making fusion polypeptide subunits and hexameric proteins, and methods of use, e.g., treatment of cancer..
Medimmune Limited

new patent

Influenza hemagglutinin proteins and methods of use thereof

In some embodiments the present invention provides influenza hemagglutinin (“ha”) polypeptides, proteins, and protein complexes that comprise a stalk domain that is engineered to facilitate maintenance of its native trimeric conformation, even if the head domain of the ha protein is removed or disrupted. In some embodiments, the present invention provides compositions comprising such polypeptides, proteins, and protein complexes, and methods of use of such proteins and compositions, for example as vaccine immunogens..
Avatar Medical, Llc

new patent

Toll-like receptor 2 agonists and vaccines and uses thereof

The present invention relates to toll-like receptor 2 (tlr2) agonists, in particular, to tlr2-activating lipoproteins, and more particularly to tlr2-activating lipopeptides derived from the bacteria bordetella pertussis. The invention further extends to the use of said tlr2-activating lipoproteins as a therapeutic or as part of a vaccine composition in the treatment and prevention of infectious diseases, cancer or allergic diseases..
The Provost, Fellows, Foundation Scholars & The Other Members Of Board, Of The College Of The Holy

new patent

Antigen specific multi epitope vaccines

The presently described subject matter relates to cancer vaccines composed of the signal peptide domain of tumor associated antigens or proteins. The described peptide vaccines have multiple mhc class i and class ii epitopes which are highly abundant in the population.
Vaxil Biotherapeutics Ltd.

new patent

Tumor vaccination involving a humoral immune response against self-proteins

The present invention relates to tumor immunotherapy, in particular to tumor vaccination, using chimeric proteins comprising all or a portion of a hepatitis b virus core antigen protein and an amino acid sequence comprising an epitope derived from the extracellular portion of a tumor-associated antigen. In particular, the present invention provides virus-like particles comprising said chimeric proteins, which are useful for eliciting a humoral immune response in a subject against the tumor-associated antigen, in particular against cells carrying said tumor-associated antigen on their surface, wherein the tumor-associated antigen is a self-protein in said subject..
Biontech Ag

new patent

Methods of treatment using hemopexin compositions

The present invention relates generally to a method of purifying proteins. More specifically, the present inventions relates to a method of purifying haptoglobin and hemopexin from the same starting material, and uses thereof..
Csl Behring Ag

new patent

Methods for inhibiting cellular uptake of the anthrax lethal toxin (lt) protein complex

The present invention identifies compounds that disrupt the interaction between anthrax proteins and lrp5/6 receptors, resulting in a reduction in anthrax toxicity. The compounds act to disrupt the intracellular transport of toxin complexes into a target cell.
Enzo Biochem, Inc.

new patent

Mutant ros expression in human cancer

The invention provides the identification of the presence of mutant ros protein in human cancer. In some embodiments, the mutant ros are fig-ros fusion proteins comprising part of the fig protein fused to the kinase domain of the ros kinase.
Cell Signaling Technology, Inc.

new patent

Carrier-antibody compositions and methods of making and using the same

Described herein are compositions of antibodies and carrier proteins and methods of making and using the same, in particular, as a cancer therapeutic. Also described are lyophilized compositions of antibodies and carrier proteins and methods of making and using the same, in particular, as a cancer therapeutic..
Mayo Foundation For Medical Education And Research

Compositions and methods for diagnosing barrett's esophagus stages

Provided is an immunohistochemistry panel that facilitates the discrimination between the early and late stages of barret's esophagus in a method that involves testing a biological sample for expression of cdx2, p120ctn, c-myc and jagged1 proteins, comparing the amount of the cdx2, p120ctn, c-myc and jagged1 proteins to reference values, and providing a diagnosis of or aiding in a physician's diagnosis, of the individual as having high-grade dysplasia (hgd) or esophageal adenocarcinoma (eac) by determining less cdx2 protein relative to non-dysplastic barrett's esophagus (nd-be) and low-grade dysplasia (lgd) cdx2 protein values, but more cdx2 protein than a normal cdx2 protein reference value; and less p120ctn protein relative to nd-be, lgd and normal 120ctn protein reference values; and increased c-myc protein relative to nd-be and lgd protein reference values; and increased jagged1 protein relative to normal and nd-be jagged1 protein reference values. Kits for making the protein determinations are also provided..
The Penn State Research Foundation

Method for high-throughput protein detection with two antibody microarrays

The invention provides a method for detecting one or more biological ligands, where the method generally uses two arrays of biological reagents. The two arrays have two different functionalities: the first array captures the ligands on the array; and the second array delivers detecting reagents to the captured ligands.

Enhancing serological assays via fusion proteins

A serological assay with an improved linear range of detection is disclosed using a fusion protein system, such as an anti-cytokine/cytokine fusion protein (acyf) system, for evaluating immune responses. Also disclosed are related compositions, fusion proteins, expression vectors, monoclonal antibodies, and kits for practicing the assay method of the present invention..
Cornell University

Small-molecule hydrophobic tagging of fusion proteins and induced degradation of same

The present invention includes compounds that are useful in perturbing or disrupting the function of a transmembrane or intracellular protein, whereby binding of the compounds to the transmembrane or intracellular protein induces proteasomal degradation of the transmembrane or intracellular protein. The present invention further includes a method of inducing proteasomal degradation of a transmembrane or intracellular protein.
Yale University

Nanoscale imaging of proteins and nucleic acids via expansion microscopy

The invention enables in situ genomic and transcriptomic assessment of nucleic acids to be conducted in biological specimens that have been physically expanded. The invention leverages the techniques for expansion microscopy (exm) to provide new methods for in situ genomic and transcriptomic assessment of nucleic in a new process referred to herein as “expansion fluorescent in situ hybridization” (exfish)..
Massachusetts Institute Of Technology

Corn genes zmspl1 and zmspl2 and uses thereof

The corn genes zmspl1 and zmspl2 are provided. The proteins encoded by these genes and the uses of these genes are also provided..
China Agricultural University

Gene products of bacillus licheniformis which form odorous substances and improved biotechnological production methods based thereon

The present invention relates to 25 hitherto undescribed genes of b. Licheniformis and gene products derived thereform and all sufficiently homologous nucleic acids and proteins thereof.
Basf Se

Micrornas 206 and 21 cooperate to promote ras-extracellular signal-regulated kinase signaling by suppressing the translation of rasa1 and spred1

The present invention provides a method for inhibiting the ras-erk pathway by upregulation of rasa1 and spred1 mrnas in tumor cells by anti-mir treatment. The method includes wherein an anti-mir-206 binds to a nucleotide comprising the sequence uagcuuaucagacu (seq id no: 21), or to a nucleotide comprising the sequence uggaauguaaggaagugugugg (seq id no: 9).
West Virginia University

Compositions, methods and uses for multiplex protein sequence activity relationship mapping

Embodiments herein concern systems, compositions, methods and uses for in vivo selection of optimum target proteins of use in designing genomically-engineered cells or organisms. Some embodiments relate to compositions and methods for generating barcoded constructs of use in systems and methods described..
The Regents Of The University Of Colorado, A Body Corporate

Treatment of gluten intolerance and related conditions

Provided herein are compositions, foods comprising nepenthesin or a derivative thereof and methods of using nepenthesin or a derivative thereof for modulating gluten intolerance and related conditions, such as celiac disease. Further provided herein are pharmaceutical compositions comprising nepenthesin or a derivative thereof and methods of using nepenthesin or a derivative thereof to treat bacterial infections of the gastrointestinal tract, such as c.
Nepetx, Llc

Enhancement of recombinant protein expression with copper

The present invention provides a novel use of copper (cupric ion) for improved cell expression of recombinant proteins, particularly coagulation proteins such as recombinant factor viii, b domain deleted recombinant factor viii, recombinant factor ix and rfvii or rfviia. The use of such cell culture supplement results in higher productivity and robustness of the manufacturing process.
Advantech Bioscience Farmacêutical Ltda





Follow us on Twitter
twitter icon@FreshPatents

###

This listing is a sample listing of patent applications related to Proteins for is only meant as a recent sample of applications filed, not a comprehensive history. There may be associated servicemarks and trademarks related to these patents. Please check with patent attorney if you need further assistance or plan to use for business purposes. This patent data is also published to the public by the USPTO and available for free on their website. Note that there may be alternative spellings for Proteins with additional patents listed. Browse our RSS directory or Search for other possible listings.


1.9667

file did exist - 2745

0 - 1 - 61