Popular terms

[SEARCH]

Polynucleotide topics
Nucleotide
Polynucleotide
Polypeptide
Antagonist
Nucleic Acid
Cancer Cell
Drug Resistance
Chromosome
Glycoprotein
Gastrointestinal
Gastrointestinal Stromal Tumors
Gastrointestinal Stromal Tumor
Cellobiohydrolase
Human Disease
Inflammation

Follow us on Twitter
twitter icon@FreshPatents

Web & Computing
Cloud Computing
Ecommerce
Search patents
Smartphone patents
Social Media patents
Video patents
Website patents
Web Server
Android patents
Copyright patents
Database patents
Programming patents
Wearable Computing
Webcam patents

Web Companies
Apple patents
Google patents
Adobe patents
Ebay patents
Oracle patents
Yahoo patents

[SEARCH]

Polynucleotide patents



      
           
This page is updated frequently with new Polynucleotide-related patent applications. Subscribe to the Polynucleotide RSS feed to automatically get the update: related Polynucleotide RSS feeds. RSS updates for this page: Polynucleotide RSS RSS



Date/App# patent app List of recent Polynucleotide-related patents
08/20/15
20150232918 
 Analyzing messenger rna and micro rna in the same reaction mixture patent thumbnailAnalyzing messenger rna and micro rna in the same reaction mixture
The present teachings provide methods, compositions, and kits for performing primer extension reactions on at least two target polynucleotides in the same reaction mixture. In some embodiments, a reverse transcription reaction is performed on a first target polynucleotide with a hot start primer comprising a self-complementary stem and a loop, and extension products form at high temperatures but extension products form less so at low temperatures since the self-complementary stem of the hot start primer prevents hybridization of the target specific region to the target.
Applied Biosystems, Llc


08/20/15
20150232905 
 Methods of activating clostridial toxins patent thumbnailMethods of activating clostridial toxins
The specification discloses modified clostridial toxins comprising an exogenous clostridial toxin di-chain loop protease cleavage site located within the di-chain loop region; polynucleotide molecules encoding such modified clostridial toxins; method of producing such modified clostridial toxins, method of activating such modified clostridial toxins and methods of activating recombinantly-expressed clostridial toxins.. .
Allergan, Inc.


08/20/15
20150232894 
 Lactate dehydrogenase mutant, polynucleotide coding for the mutant, yeast cell including the polynucleotide,  preparing the mutant, and  producing the lactate using the same patent thumbnailLactate dehydrogenase mutant, polynucleotide coding for the mutant, yeast cell including the polynucleotide, preparing the mutant, and producing the lactate using the same
A lactate dehydrogenase mutant, a polynucleotide encoding the mutant, a recombinant yeast cell including the polynucleotide, and a method of preparing the mutant and a method of producing lactate by using the same.. .
Samsung Electronics Co., Ltd.


08/20/15
20150232867 
 Heavy metal reduction in planta patent thumbnailHeavy metal reduction in planta
There is described a mutant, non-naturally occurring or transgenic plant or plant cell comprising (a) a polynucleotide selected from the group consisting of: (i) a polynucleotide comprising, consisting or consisting essentially of a sequence having at least 71% sequence identity to seq id nos: 1, 2, 27, 28 or 29 or 51; or (ii) a polynucleotide comprising, consisting or consisting essentially of a sequence having at least 65% sequence identity to any of seq id nos: 3 to 23 or 30 to 50; or (iii) a polynucleotide encoding a ntmrp polypeptide comprising, consisting or consisting essentially of a sequence having at least 65% sequence identity to any of seq id nos. 24 to 26 or 52, and wherein the polypeptide has heavy metal transporter activity; or (b) a polynucleotide construct of at least 15 contiguous nucleotides in length that is at least 65% identical to a region of any of seq id nos: 1 to 23 or 27 to 51; or (c) a double-stranded rna comprising at least two sequences that are at least partially complementary to each other and wherein a sense strand comprises a first sequence and an antisense strand comprises a second sequence and wherein at least one of the sequences comprises at least 10 contiguous nucleotides of ntmrp rna; or (d) an expression vector comprising the polynucleotide as set forth in (i), (ii) or (iii) or the polynucleotide construct as set forth in (b)..
Philip Morris Products S.a.


08/20/15
20150232866 
 Plant regulatory elements and uses thereof patent thumbnailPlant regulatory elements and uses thereof
The present invention provides novel dna molecules and constructs, including their nucleotide sequences, useful for modulating gene expression in plants and plant cells. The invention also provides transgenic plants, plant cells, plant parts, seeds, and commodity products comprising the dna molecules operably linked to heterologous transcribable polynucleotides, along with methods of their use..
Monsanto Technology Llc


08/20/15
20150232860 
 Multi-species polynucleotide control sequences patent thumbnailMulti-species polynucleotide control sequences
The present invention relates to polynucleotide sequences which enable a polynucleotide control sequence, such as a promoter, to direct expression in a wide range of industrially relevant species, both prokaryotes and eukaryotes. When the polynucleotide sequences of the invention are applied in combination with selection marker genes it is possible to perform selectable cloning in a laboratory host and use the same construct in the final host.
Dsm Ip Assets B.v.


08/20/15
20150232850 
 Treatment of insulin receptor substrate 2 (irs2) related diseases by inhibition of natural antisense transcript to irs2 and transcription factor e3 (tfe3) patent thumbnailTreatment of insulin receptor substrate 2 (irs2) related diseases by inhibition of natural antisense transcript to irs2 and transcription factor e3 (tfe3)
The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of insulin receptor substrate 2 (irs2) polynucleotides, in particular, by targeting natural antisense polynucleotides of insulin receptor substrate 2 (irs2) polyneucleotides and transcription factor e3 (tfe3). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of irs2..
Curna, Inc.


08/20/15
20150232825 
 Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same patent thumbnailPolypeptides having cellulolytic enhancing activity and polynucleotides encoding same
Provided are isolated polypeptides having cellulolytic enhancing activity, and polynucleotides encoding the polypeptides. Also provided are nucleic acid constructs, vectors and host cells comprising the polynucleotides as well as methods of producing and using polypeptides..
Novozymes A/s


08/20/15
20150232824 
 Glucoamylase variants and polynucleotides encoding same and uses thereof patent thumbnailGlucoamylase variants and polynucleotides encoding same and uses thereof
The present invention relates to variants of a parent glucoamylase. The present invention also relates to polynucleotides encoding the variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the glucoamylase variants..
Novozymes A/s


08/20/15
20150232822 
 Dna polymerases having improved labeled nucleotide incorporation properties patent thumbnailDna polymerases having improved labeled nucleotide incorporation properties
In addition to providing novel mutant dna polymerases, the invention also provides polynucleotides encoding the subject mutant dna polymerases. The polynucleotides provided may comprise expression vectors for the recombinant production of the mutant polymerases.

08/20/15
20150232817 

Polypeptides having peroxygenase activity


The present invention relates to isolated polypeptides having peroxygenase activity, and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.
Novozymes A/s


08/20/15
20150232816 

Polypeptides having peroxygenase activity


The present invention relates to isolated polypeptides having peroxygenase activity, and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.
Novozymes A/s


08/20/15
20150231275 

Thymidine kinase


A polynucleotide comprising a nucleotide sequence encoding a thymidine kinase wherein at least one of the nucleotides corresponding to the splice donor site nucleotides is replaced by another nucleotide and wherein the nucleotides of the splice acceptor sites are not altered.. .
Molmed Spa


08/20/15
20150231254 

Polynucleotide-poly(diol) conjugates, process of preparation and uses thereof


Wherein each wherein each x, nt, r, n, m and j are as defined herein. There is also provided a process for preparing a substantially monodisperse conjugate, a composition comprising said conjugate, and the use of a conjugate as defined herein in therapy..

08/20/15
20150231214 

Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of phenylalanyl-beta-trna synthetases


Provided are compositions comprising newly identified protein fragments of aminoacyl-trna synthetases, polynucleotides that encode them and complements thereof, related agents, and methods of use thereof in diagnostic, drug discovery, research, and therapeutic applications.. .
Pangu Biopharma Limited


08/20/15
20150231211 

Fibronectin based scaffold domain proteins that bind to myostatin


The present invention relates to fibronectin-based scaffold domain proteins that bind to myostatin. The invention also relates to the use of these proteins in therapeutic applications to treat muscular dystrophy, cachexia, sarcopenia, osteoarthritis, osteoporosis, diabetes, obesity, copd, chronic kidney disease, heart failure, myocardial infarction, and fibrosis.
Bristol-myers Squibb Company


08/20/15
20150231206 

Variant activin receptor polypeptides and uses thereof


The present invention provides variant activin iib soluble receptor polypeptides and proteins capable of binding and inhibiting the activities of activin a, myostatin, or gdf-11. The present invention also provides polynucleotides, vectors and host cells capable of producing the variant polypeptides and proteins.
Amgen Inc.


08/13/15
20150225787 

Methods for sequencing polynucleotides


Provided herein is a method for sequencing a polynucleotide molecules. The method includes the steps of providing a plurality of polynucleotide molecules attached to a surface, wherein a first portion of each polynucleotide molecule is attached to a first location of the surface and a second portion of each polynucleotide molecule is attached to a second location of the surface, the relative proximity of the first and second locations being correlated with the probability that the first and second portions are paired, separating the first and second portions of the polynucleotide molecules on the surface, determining the sequences of the first and second portions of the polynucleotide molecules and comparing the relative proximities and the sequences to determine which first and second portions are paired and to determine the sequence of the target polynucleotide molecules..
Illumina Cambridge Limited


08/13/15
20150225781 

Silver nanocluster probe and target polynucleotide detection method using same, and silver nanocluster probe design method


The present invention provides a silver nanocluster probe which comprises a silver nanoparticle binding region and a specific nucleotide sequence region that specifically binds to a target polynucleotide, wherein the silver nanocluster probe is configured such that it will emit detectable light when silver nanoparticles bind to the silver nanoparticle binding region to form a silver nanocluster, but light emission from the silver nanocluster probe will decrease or decay when the target polynucleotide binds to the specific nucleotide sequence region. According to the present invention, either the presence of a target polynucleotide in a sample or a mutation in the target polynucleotide can be detected in a rapid and convenient manner by determining whether light emission decreases or decays when the target polynucleotide binds to the specific nucleotide sequence region of the silver nanocluster probe that emits detectable light..
Seoulin Bioscience Co., Ltd.


08/13/15
20150225761 

Methods for producing polypeptides in protease-deficient mutants of trichoderma


The present invention relates to mutants of a parent trichoderma strain, comprising a polynucleotide encoding a polypeptide and one or more (several) genes selected from the group consisting of a first subtilisin-like serine protease gene, a first aspartic protease gene, a trypsin-like serine protease gene, a second subtilisin-like serine protease gene, and a second aspartic protease gene, wherein the one or more (several) genes are modified rendering the mutant strain deficient in the production of one or more (several) enzymes selected from the group consisting of a first subtilisin-like serine protease, a first aspartic protease, a trypsin-like serine protease, a second subtilisin-like serine protease, and a second aspartic protease, respectively, compared to the parent trichoderma strain when cultivated under identical conditions. The present invention also relates to methods of producing a polypeptide in such mutants and methods for producing such mutants..
Novozymes, Inc.


08/13/15
20150225725 

Treatment of fibroblast growth factor 21 (fgf21) related diseases by inhibition of natural antisense transcript to fgf21


The present invention relates to antisense of oligonucleotides that modulate the expression of and/or function of fibroblast growth factor 21 (fgf21), in particular, by targeting natural antisense polynucleotides of fibroblast growth factor 21 (fgf21). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of fgf21..
Curna, Inc.


08/13/15
20150225724 

Treatment of adiponectin (adipoq) related diseases by inhibition of natural antisense transcript to an adiponectin (adipoq)


The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of an adiponectin (adipoq), in particular, by targeting natural antisense polynucleotides of an adiponectin (adipoq). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of adiponectins (adipoq)s..
Curna, Inc.


08/13/15
20150225718 

Antisense polynucleotides to induce exon skipping and methods of treating dystrophies


Antisense polynucleotides and their use in pharmaceutical compositions to induce exon skipping in targeted exons of the gamma sarcoglycan gene are provided, along with methods of preventing or treating dystrophic diseases such as limb-girdle muscular dystrophy. One aspect the disclosure provides an isolated antisense polynucleotide wherein the polynucleotide specifically hybridizes to an exon target region of a gamma sarcoglycan rna, wherein the exon is selected from the group consisting of exon 4 (seq id no:1), exon 5 (seq id no: 2), exon 6 (seq id no: 3), exon 7 (seq id no: 4) and a combination thereof.
The University Of Chicago


08/13/15
20150225701 

Novel nylanderia pubens virus


At least one novel virus capable of infecting crazy ants (nylanderia pubens) is isolated, along with polynucleotide sequences and amino acid sequences of the virus(es). The virus(es) is capable of be used as a biopesticide to control populations of crazy ants..
The United States Of America, As Represented By The Secretary Of Agriculture


08/06/15
20150219645 

Methods for detecting a mycobacterium tuberculosis infection


Methods for detecting an infection with mycobacterium tuberculosis (mtb) in a subject are disclosed. The methods include detecting the presence of cd8+ t cells that specifically recognize an mtb polypeptide.
The Government Of The United States Of America, Dba The Department Of Veterans Affairs


08/06/15
20150218659 

Cotton transgenic event mon 88701 and methods of use thereof


The invention provides cotton event mon 88701, and plants, plant cells, seeds, plant parts, and commodity products comprising event mon 88701. The invention also provides polynucleotides specific for event mon 88701 and plants, plant cells, seeds, plant parts, and commodity products comprising polynucleotides specific for event mon 88701.
Monsanto Technology Llc


08/06/15
20150218636 

Mutations in calmodulin genes


The present invention relates to an isolated polynucleotide encoding at least a part of calmodulin and an isolated polypeptide comprising at least a part of a calmodulin protein, wherein the polynucleotide and the polypeptide comprise at least one mutation associated with a cardiac disorder. The present invention also relates to a method for determining whether an individual has an increased risk of contracting a cardiac disorder, a method for diagnosing a cardiac disorder, method for treatment of an individual having a cardiac disorder, method for identifying a compound, capable of enhancing the binding of calmodulin to ryanodine receptor 2 and use of such compound in a treatment of an individual having a cardiac disorder.
Aalborg Universitet


08/06/15
20150218633 

Methods and systems for processing polynucleotides


The present disclosure provides compositions, methods, systems, and devices for polynucleotide processing. Such polynucleotide processing may be useful for a variety of applications, including polynucleotide sequencing..
10x Genomics, Inc.


08/06/15
20150218631 

Methods of fetal abnormality detection


Methods and kits for selectively enriching non-random polynucleotide sequences are provided. Methods and kits for generating libraries of sequences are provided.
Verinata Health, Inc.


08/06/15
20150218629 

Enzyme construct


The invention relates to methods using constructs comprising a helicase and an additional polynucleotide binding moiety. The helicase is attached to the polynucleotide binding moiety and the construct has the ability to control the movement of a polynucleotide.
Oxford Nanopore Technologies Limited


08/06/15
20150218608 

Compositions and methods for improvement of ligation yields


Methods and compositions are provided for increasing the ligation yields of polynucleotides in vitro.. .
New England Biolabs, Inc.


08/06/15
20150218583 

Axmi-234 and axmi-235 delta-endotoxin genes and methods for their use


Compositions and methods for conferring pesticidal activity to bacteria, plants, plant cells, tissues and seeds are provided. Compositions comprising a coding sequence for a toxin polypeptide are provided.
Athenix Corp.


08/06/15
20150218577 

Sucrose transporter genes for increasing plant seed lipids


This invention relates to polynucleotide sequences encoding sut2 or sut4 sucrose transporter genes. Methods for increasing seed oil content and evaluating increased oil content in a plant seed are described.
E I Du Pont De Nemours And Company


08/06/15
20150218562 

Wound treatment


The present invention concerns an isolated polynucleotide comprising a nucleotide sequence having substantial homology to any of the following nucleotide sequences: catcgttatgggacta (seq id no: 2), cattcttgatccttcc (seq id no: 1), cttttcaatctgactg seq id no: atgaaaatactcataa (seq id no: 5), gtgataaaagaaccat (seq id no: 10), gggttcatgaaagtga (seq id no: 11), gatgaccctcttatcc (seq id no: 8), tggaaggaatgtctgg (seq id no: 4), gcatctgcttccaaca (seq id no: 3), catcgttaggctagctacaacgatgggacta (seq id no: 9), tccaccaaggctagctacaacgaccatcaaa (seq id no: 12), gtcaacaaggctagctacaacgatgagctca (seq id no: 13), and cttttcaaggctagctacaacgactgactgt (seq id no: 6), and their use in the treatment of wounds.. .
Coda Therapeutics, Inc.


08/06/15
20150218553 

Screening polynucleotide libraries for variants that encode functional proteins


The present invention provides methods based on screening expressed polynucleotide libraries for soluble proteins.. .
Novozymes A/s


08/06/15
20150218542 

Polypeptides having cellobiohydrolase i activity and polynucleotides encoding same


The present invention relates to polypeptides having cellobiohydrolase i activity and polynucleotides having a nucleotide sequence which encodes for the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the nucleic acid constructs as well as methods for producing and using the polypeptides..
Novozymes A/s


08/06/15
20150218541 

Variant endoglucanases and related polynucleotides


The invention provides variants of the clostridium thermocellum endoglucanase (celg) that have improved endoglucanase activity compared to the wild type enzyme. Also provided are related polynucleotides, compositions, vectors, host cells, and methods of use..
Codexis, Inc.


08/06/15
20150218529 

Polypeptides having peroxygenase activity


The present invention relates to isolated polypeptides having peroxygenase activity, and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.
Novozymes A/s


08/06/15
20150218527 

Biocatalysts for ezetimibe synthesis


The present disclosure relates to non-naturally occurring polypeptides useful for preparing ezetimibe, polynucleotides encoding the polypeptides, and methods of using the polypeptides.. .
Codexis Inc.


08/06/15
20150218526 

Down-regulation of a polynucleotide encoding a sou2 sorbitol utilization protein to modify lipid production in microbial cells


Recombinant microbial cells are disclosed herein that comprise (i) a down-regulation of an endogenous polynucleotide sequence encoding sou2 sorbitol utilization protein, and (ii) a polyunsaturated fatty acid (pufa) biosynthetic pathway. The down-regulation of the polynucleotide sequence encoding sou2 sorbitol utilization protein can increase the lipid content of the microbial cells and/or decrease the total amount of sugar alcohols produced by the microbial cells.
E I Du Pont De Nemours And Company


08/06/15
20150218284 

Cd27l antigen binding proteins


The present invention relates to cd27l antigen binding proteins, such an antibodies, polynucleotides encoding said cd27l antigen binding proteins, antibody drug conjugate compositions, and methods for diagnosing and treating diseases associated with cd27l expression.. .
Amgen Inc.


08/06/15
20150218275 

Anti-cd16 binding molecules


The present invention relates to binding molecules that specifically bind to the human fc gamma receptor expressed on the surface of natural killer (nk) cells and macrophages (i.e. Fcγriiia), and in particular binding molecules that specifically bind the a form fcγriii but do not bind to the b form of fcγriii, as well as to the use of such binding molecules in the diagnosis and treatment of disease.
Affimed Gmbh


08/06/15
20150218260 

Interleukin-2 fusion proteins and uses thereof


The present invention generally relates to fusion proteins of immunoglobulins and interleukin-2 (il-2). More particularly, the invention concerns fusion proteins of immunoglobulins and mutant il-2 that exhibit improved properties for use as therapeutic agents, e.g.
Hoffman-la Roche Inc.


08/06/15
20150218244 

Interleukin-10 fusion proteins and uses thereof


The present invention generally relates to fusion proteins of antibodies and interleukin-10 (il-10). More particularly, the invention concerns fusion proteins of antibodies and mutant il-10 that exhibit improved properties for use as therapeutic agents, e.g.
Hoffmann-la Roche Inc.


08/06/15
20150218243 

P15 protein variant and use thereof for preventing or treating cancer


A p15 protein variant; a polynucleotide encoding the p15 protein variant; a method for preparing the p15 protein variant; a pharmaceutical composition comprising the p15 protein variant; and a method for preventing and/or treating cancer comprising administering the p15 protein variant to a subject.. .
Samsung Electronics Co., Ltd.


08/06/15
20150218240 

P16 protein variant and use thereof for preventing or treating cancer


A p16 protein variant; a polynucleotide encoding the p16 protein variant; a method for preparing the p16 protein variant; a pharmaceutical composition comprising the p16 protein variant; a method for preventing and/or treating cancer comprising administering the p16 protein variant to a subject; and use of the p16 protein variant in the prophylaxis and/or therapy of cancer.. .
Samsung Electronics Co., Ltd.


08/06/15
20150218231 

Genes of an otitis media isolate of nontypeable heamophilus influenzae


The invention relates to the polynucleotide sequence of a nontypeable strain of haemophilus influenza (nthi) and polypeptides encoded by the polynucleotides and uses thereof. The invention also relates to nthi genes which are upregulated during or in response to nthi infection of the middle ear and/or the nasopharynx..
The Board Of Regents Of University Of Oklahoma


08/06/15
20150218230 

Methods for modulating tal specificity


Methods for improving or modulating targeting specificity of tale proteins by introducing alternative rvds into their modular nucleic acid binding domains. Polynucleotides encoding tale proteins having alternative targeting specificity towards a nucleic acid target sequence.
Cellectis, S.a.


08/06/15
20150218214 

Peptide and the use thereof


Provided are a peptide comprising the amino acid sequence of deaqetavssheqd, the polynucleotide encoding it, the uses of said peptide for the treatment of the symptoms associated with pain and for the inhibition of the activity of influenza virus, and a pharmaceutical composition containing said peptide.. .

08/06/15
20150217129 

System and therapeutic management of ocular hypertension


One embodiment is directed to a method for treating hypertension within the eye of a patient, comprising: delivering an effective amount of polynucleotide comprising an exogenous receptor genetic material which is expressed in a targeted tissue structure of the eye, wherein the targeted tissue structure has been genetically modified to have light sensitive protein; waiting for a period of time to ensure that sufficient portions of the targeted tissue structure of the eye will express the desired light sensitive protein; and causing controlled mechanical changes to the permeability of the eye by directing light to the targeted tissue structure through a light deliver element optically intercoupled between a light source and the targeted tissue structure of the eye.. .
Circuit Therapeutics, Inc.


08/06/15
20150217000 

Minicircle dna vector preparations and methods of making and using the same


The present invention provides minicircle nucleic acid vector formulations for use in administering to a subject, wherein the minicircle nucleic acid vectors include a polynucleotide of interest, a product hybrid sequence of a unidirectional site-specific recombinase, and are devoid of plasmid backbone bacterial dna sequences. Also provided are methods of producing the subject formulations as well as methods for administering the minicircle nucleic acid vector formulations to a subject.
The Board Of Trustees Of The Leland Stanford Junior University


08/06/15
20150216828 

Production of omega-3 long chain polyunsaturated fatty acids


A recombinant camelina plant or cell comprising one or more polynucleotides encoding a Δ6-desaturase, a Δ6-elongase and a Δ5-desaturase operably linked with one or more regulatory sequences.. .
Rothamsted Research Ltd.


07/30/15
20150211076 

Polynucleotide primers


A polynucleotide primer comprising at least the final six nucleotides of one of the following primer sequences, or a sequence complementary thereto: seq. Id nos.
Qiagen Manchester Limited


07/30/15
20150211071 

Mir-18b for use as a marker of cancer progression and target for therapies to treat cancer


The disclosure provides methods for predicting and/or determining whether a subject has cancer based on the level of expression of mir-18b. The disclosure also provides methods for determining whether a cancer in a subject is progressing or regressing based upon the change of expression levels of mir-18b between two time points.
Sutter West Bay Hospitals


07/30/15
20150211040 

Methods of production of products of metabolic pathways


Wherein the first, second and third regulatory sequence are selected such that the expression of the icy-b and the crtw is greater than a level of expression of the crti. Methods of generating astaxanthin using the plurality of polynucleotide are also disclosed as well as bacterial cells comprising high levels of astaxanthin..

07/30/15
20150211039 

Enzymes and polymerases for the synthesis of rna


The invention relates to compositions and methods for the design, evolution, preparation, and/or manufacture of enzymes for use with polynucleotides, primary transcripts and mmrna molecules.. .
Moderna Therapeutics, Inc.


07/30/15
20150211037 

Polypeptides for use in the deconstruction of cellulose


Hydrolysis and degradation of cellulose-containing biomass by use of a polypeptide having cellulase activity is provided. Also provided are polypeptides having cellulase activity, such as archaeal cellulases, polynucleotides encoding the polypeptides, and compositions containing the polypeptides, and methods of use thereof..
The Regents Of The University Of California


07/30/15
20150211036 

Genes and processes for the production of clavine-type alkaloids


Microorganisms and processes for the recombinant manufacture of clavine-type alkaloids such as cycloclavine, festuclavine, agroclavine, chanoclavine and chanoclavine aldehyde, as well as polypeptides, polynucleotides and vectors comprising such polynucleotides which can be applied in a method for the manufacture of clavine-type alkaloids are provided.. .
Evolva Sa


07/30/15
20150211032 

Isolation and characterization of a novel pythium omega 3 desaturase with specificity to all omega 6 fatty acids longer than 18 carbon chains


The present invention relates to a polynucleotide encoding an omega 3 (ω-3) desaturase from pythium irregulare with specificity to long chain polyunsaturated omega 6 (ω-6) fatty acids as well as a vector containing the polynucleotide, and a host cell containing the vector or the polynucleotide. Moreover, the present invention pertains to a polypeptide encoded by the polynucleotide, antibodies against the polypeptide as well as a method for the manufacture of the polypeptide.
Bioriginal Food & Science Corp.


07/30/15
20150211024 

Methods for production of a terpene and a co-product


The present disclosure generally relates to microorganisms (e.g., non-naturally occurring microorganisms) that comprise one or more polynucleotides coding for enzymes in a pathway that catalyze a conversion of a carbon source (e.g., a fermentable carbon source) to terpene and a co-product such as succinate, 1,3-butanediol, or crotonyl alcohol and the use of such microorganisms for the production of terpene and a co-product such as succinate, 1,3-butanediol, or crotonyl alcohol.. .
Braskem S.a.


07/30/15
20150211019 

Compositions and methods for increasing pest resistance in plants


Compositions and methods of reducing expression of a flavonoid glucosyltransferase plants, and transgenic and hybrid plants with increased pest resistance are disclosed. The plants can express a polynucleotide that alters, reduces, or silences expression of a flavonoid glucosyltransferase.
University Of Georgia Research Foundation, Inc.


07/30/15
20150211012 

Mycobacterium comprising expression vector with two auxotrophic selection markers and its use as vaccine


The invention relates to polynucleotides and recombinant cell strains comprising the polynucleotides and the uses thereof for the delivery of the polypeptides encoded by the polynucleotides to a subject in need thereof. In particular, the invention refers to polynucleotides comprising a polypeptide of interest, auxotrophy-complementing genes and the use thereof in a mycobacterial double auxotrophic host cell to achieve the stable expression of the polypeptide of interest by using an antibiotic-free plasmid selection system..
FundaciÓ Privada Institut De Recerca De La Sida - Caixa


07/30/15
20150210995 

Thermostable asparaginase variants and polynucleotides encoding same


The present invention relates to asparaginase variants. The present invention also relates to polynucleotides encoding the variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the variants.
Novozymes A/s


07/30/15
20150210988 

Transaminase polypeptides


The present disclosure provides engineered transaminase enzymes having improved properties as compared to a naturally occurring wild-type transaminase enzyme. Also provided are polynucleotides encoding the engineered transaminase enzymes, host cells capable of expressing the engineered transaminase enzymes, and methods of using the engineered transaminase enzymes to synthesize a variety of chiral compounds..
Codexis Inc.


07/30/15
20150210752 

Albumin variants


The present invention relates to variants of a parent albumin, the variants having altered plasma half-life compared with the parent albumin. The present invention also relates to polynucleotides encoding the variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the variants..
Novozymes Biopharma Dk A/s


07/30/15
20150210017 

Method of preparing porous metal oxide structure


Provided is an example method of preparing a porous metal oxide structure, the method including adsorbing a metal oxide precursor onto a template having a networked structure of branched polynucleotides, decomposing and converting the adsorbed metal oxide precursor into a metal oxide, and removing the template. The networked structure of branched polynucleotides may be used as a template so as to facilitate control of the pore structure of a porous metal oxide structure..
Postech Academy-industry Foundation


07/30/15
20150209420 

Novel prime-boosting regimens involving immunogenic polypeptides encoded by polynucleotides


The present invention relates to administration regimens which are particularly suited for vaccine composition comprising polynucleotides which encode immunogenic polypeptides. Said administration regimens involve, the repeated administration of a vaccine composition and enhance the immune response against the immunogenic polypeptide..
Okairos Sa


07/30/15
20150209418 

Modified beta-lactamases and methods and uses related thereto


Still further, the invention relates to a polynucleotide and a host cell comprising the polynucleotide.. .

07/23/15
20150205914 

System and methods for detecting genetic variation


The invention provides methods, apparatuses, and compositions for high-throughput amplification sequencing of specific target sequences in one or more samples. In some aspects, barcode-tagged polynucleotides are sequenced simultaneously and sample sources are identified on the basis of barcode sequences.
Counsyl, Inc.


07/23/15
20150203926 

Primer set for detecting bovine leukemia virus and use thereof


A forward primer of a primer set in accordance with the present invention for detecting blv is a mixture of (1) a first primer consisting of a polynucleotide including 15 or more successive bases including the 16th c in the base sequence of seq id no: 1 and (2) a second primer consisting of a plurality of kinds of polynucleotides including at least the first to 15th bases in the base sequence of seq id no: 2. Two or more of m, n, y, k, and d which are included in the second primer are each a degenerate base which specifies two or more kinds of bases, and the second primer includes at least 10 kinds of polynucleotides including at least the first to 15th bases in the base sequences of seq id nos: 3 to 12..
Riken Genesis Co., Ltd.


07/23/15
20150203911 

Method for sequencing a polynucleotide template


The invention relates to methods for pairwise sequencing of a double-stranded polynucleotide template, which permit the sequential determination of nucleotide sequences in two distinct and separate regions on complementary strands of the double-stranded polynucleotide template. The two regions for sequence determination may or may not be complementary to each other..
Illumina Cambridge Limited


07/23/15
20150203910 

Method for sequencing a polynucelotide template


The invention provides methods for pairwise sequencing of a double-stranded polynucleotide template, which methods result in the sequential determination of nucleotide sequences in two distinct and separate regions of the polynucleotide template.. .
Illumina Cambridge Limited


07/23/15
20150203867 

Compositions and methods for controlling leptinotarsa


Disclosed herein are methods of controlling insect pests, in particular leptinotarsa spp. Which infest crop plants, and methods of providing plants resistant to such pests.
Monsanto Technology Llc


07/23/15
20150203865 

Rnas from pathogens inhibit plant immunity


The present invention relates to pathogen-resistant plants comprising a heterologous expression cassette, the expression cassette comprising a promoter operably linked to a polynucleotide that is complementary to, or mediates destruction, of a plant immunity suppressing srna of a pathogen, wherein the plant is less susceptible to the pathogen compared to a control plant lacking the expression cassette. Methods of making and cultivating pathogen-resistant plants are also provided..
The Regents Of The University Of California


07/23/15
20150203862 

Novel glycosyltransferase gene and use thereof


A polynucleotide is provided that encodes a protein having activity that transfers a sugar to the hydroxyl group at the 4′-position of a flavone. The polynucleotide is selected from the group consisting of: (a) a polynucleotide composed of the base sequence of seq id no: 1; (b) a polynucleotide that hybridizes under stringent conditions with a polynucleotide composed of a base sequence complementary to the base sequence of seq id no: 1, and encodes a protein having activity that transfers a sugar to the hydroxyl group at the 4′-position of a flavone; (c) a polynucleotide encoding a protein composed of the amino acid sequence of seq id no: 2; and, (d) a polynucleotide encoding a protein composed of an amino acid sequence in which one or a plurality of amino acids have been deleted, substituted, inserted and/or added in the amino acid sequence of seq id no: 2, and having activity that transfers a sugar to the hydroxyl group at the 4′-position of a flavone..
Suntory Holdings Limited


07/23/15
20150203857 

Increased protein expression in plants


This disclosure concerns synthetic polynucleotides encoding a polypeptide of interest that are particularly well-suited for expression in target plants.. .
Dow Agrosciences Llc


07/23/15
20150203850 

Methods of treatment using tlr7 and/or tlr9 inhibitors


The application relates to compositions and methods of regulating an immune response comprising inhibitors of tlr7 and/or tlr9, such as immunoregulatory polynucleotides and/or immunoregulatory compounds. The application also relates to compositions and methods for predicting and/or determining responsiveness of a disease to treatment comprising inhibitors of tlr7 and/or tlr9..
Dynavax Technologies Corporation


07/23/15
20150203833 

Aspergillus containing beta-glucosidase, beta-glucosidases and nucleic acids encoding the same


A novel microorganism is provided named aspergillus saccharolyticus. Further, beta-glucosidase enzymes encoded by said microorganism are provided, and the use thereof in the degradation of lignocellulosic material.
Clean-vantage Llc


07/23/15
20150203831 

Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same


Provided are isolated polypeptides having cellulolytic enhancing activity and polynucleotides encoding the polypeptides, catalytic domains or carbohydrate binding modules. Also provided are nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides, catalytic domains or carbohydrate binding modules..
Novozymes A/s


07/23/15
20150203817 

Use of pre t alpha or functional variant thereof for expanding tcr alpha deficient t cells


A method of expanding tcralpha deficient t-cells by expressing ptalpha or functional variants thereof into said cells, thereby restoring a functional cd3 complex. This method is particularly useful to enhance the efficiency of immunotherapy using primary t-cells from donors.
Cellectis


07/23/15
20150203576 

Variants of igg fc with limited amine groups


Lysine-depleted variants of fragment crystallizable (fc) regions of immunoglobulins are disclosed. Also disclosed are fusion proteins comprised of n-terminal targeting or active peptide domains fused with such lysine-depleted variant igg-fc domains.

07/23/15
20150203558 

Long-acting polypeptides and methods of producing same


A polypeptide and polynucleotides encoding same comprising one carboxy-terminal peptide (ctp) of chorionic gonadotrophin attached to an amino terminus of a cytokine and two carboxy-terminal peptides (ctp) of chorionic gonadotrophin attached to a carboxy terminus of a cytokine are disclosed. Pharmaceutical compositions comprising the polypeptide and polynucleotides of the invention and methods of using same are also disclosed..
Opko Biologics Ltd.


07/23/15
20150203439 

Aminoalcohol lipidoids and uses thereof


Aminoalcohol lipidoids are prepared by reacting an amine with an epoxide-terminated compound are described. Methods of preparing aminoalcohol lipidoids from commercially available starting materials are also provided.
Massachusetts Institute Of Technology


07/23/15
20150202298 

Compositions for targeted delivery of sirna


The present invention is directed compositions for targeted delivery of rna interference (rnai) polynucleotides to hepatocytes in vivo. Targeted rnai polynucleotides are administered together with co-targeted delivery polymers.
Arrowhead Madison Inc.


07/16/15
20150198533 

Lucigen yellow (lucy), a yellow fluorescent protein


Described herein are isolated polynucleotides that encode a fluorescent protein which is at least 80% sequence identical to a protein selected from the group consisting of seq. Id.
Lucigen Corporation


07/16/15
20150197799 

Polynucleotide modification on solid support


The present disclosure relates to the field of molecular biology and more specifically to methods for capturing and amplifying target polynucleotides on a solid surface.. .
Illumina Cambridge Limited


07/16/15
20150197798 

Amplicon preparation and sequencing on solid supports


The present disclosure relates to the field of molecular biology and more specifically to methods for capturing, amplifying and sequencing target polynucleotides on a solid surface.. .
Illumina, Inc.


07/16/15
20150197796 

Ssb method


The invention relates to a method of characterising a target polynucleotide using a single-stranded binding protein (ssb). The ssb is either an ssb comprising a carboxy-terminal (c-terminal) region which does not have a net negative charge or a modified ssb comprising one or more modifications in its c-terminal region which decreases the net negative charge of the c-terminal region..
Oxford Nanopore Technologies Limited


07/16/15
20150197789 

End modification to prevent over-representation of fragments


The invention relates to a method of preparing a 5′ and 3′ modified library of template polynucleotides and also the use of the 5′ and 3′ modified library of templates in methods of solid-phase nucleic acid amplification. In particular, the invention relates to a method of preparing a 5′ and 3′ modified library of template polynucleotides which have common sequences at their 5′ ends and at their 3′ ends, wherein over-representation of “end” sequences of the primary polynucleotide molecules from whence the 5′ and 3′ modified library is generated is greatly reduced or prevented..
Illumina Cambridge Limited


07/16/15
20150197786 

Method for attaching a counter sequence to a nucleic acid sample


Described herein is a method for adding a counter sequence to the individual polynucleotide molecules of an initial nucleic acid sample. After addition of the counter sequence, the sample may be amplified and the number of initial target molecules in the sample can be estimated by counting the number of counter sequences associated with the amplified target molecules..
Population Genetics Technologies Ltd.


07/16/15
20150197768 

Plant transcription factors, promoters and uses thereof


polynucleotide molecules encoding transcription factors, promoter elements, binding partners and methods of use in increasing drought tolerance, yield, and abiotic stress tolerance are disclosed. Erf transcription factors and cor410b promoter sequences are disclosed..
Pioneer Hi Bred International Inc.


07/16/15
20150197763 

Soy nucleic acid molecules and other molecules associated with plants and uses thereof for plant improvement


Polynucleotides useful for improvement of plants are provided. In particular, polynucleotide sequences are provided from plant sources.
Monsanto Technology Llc


07/16/15
20150197750 

Treatment of 'iq motif containing gtpase activating protein' (iqgap) related diseases by inhibition of natural antisense transcript to iqgap


The present invention relates to antisense oligonucleosides that modulate the expression of and/or function of ‘iq motif containing gtpase activating protein’ (iqgap), in particular, by targeting natural antisense polynucleotides of ‘iq motif containing gtpase activating protein’ (iqgap). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of iqgap..
Curna, Inc.


07/16/15
20150197737 

Polypeptides having xylanase activity and polynucleotides thereof


The present invention relates to isolated polypeptides having xylanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides..
Novozymes, Inc.


07/16/15
20150197731 

Ketoreductase polypeptides for the production of azetidinone


The present disclosure provides engineered ketoreductase enzymes having improved properties as compared to a naturally occurring wild-type ketoreductase enzyme. Also provided are polynucleotides encoding the engineered ketoreductase enzymes, host cells capable of expressing the engineered ketoreductase enzymes, and methods of using the engineered ketoreductase enzymes to synthesize a variety of chiral compounds..
Codexis, Inc.


07/16/15
20150197567 

Antibodies to il-6 and use thereof


The present invention is directed to antibodies and fragments thereof having binding specificity for il-6. Another embodiment of this invention relates to the antibodies described herein, and binding fragments thereof, comprising the sequences of the vii, vl and cdr polypeptides described herein, and the polynucleotides encoding them.
Alderbio Holdings Llc


07/16/15
20150197566 

Polynucleotides encoding antagonists of il-17a, il-17f, and il-23p19


The present invention relates to blocking, inhibiting, reducing, antagonizing or neutralizing the activity of il-17a, il-17f, and il-23. Antagonists include antibodies and antibody fragments that bind il-23 and that bind il-17a or il-17f, such as antibodies that are cross-reactive for il-17a and il-17f.
Zymogenetics, Inc.




Popular terms: [SEARCH]

Polynucleotide topics: Nucleotide, Polynucleotide, Polypeptide, Antagonist, Nucleic Acid, Cancer Cell, Drug Resistance, Chromosome, Glycoprotein, Gastrointestinal, Gastrointestinal Stromal Tumors, Gastrointestinal Stromal Tumor, Cellobiohydrolase, Human Disease, Inflammation

Follow us on Twitter
twitter icon@FreshPatents

###

This listing is a sample listing of patent applications related to Polynucleotide for is only meant as a recent sample of applications filed, not a comprehensive history. There may be associated servicemarks and trademarks related to these patents. Please check with patent attorney if you need further assistance or plan to use for business purposes. This patent data is also published to the public by the USPTO and available for free on their website. Note that there may be alternative spellings for Polynucleotide with additional patents listed. Browse our RSS directory or Search for other possible listings.


0.3231

5202

0 - 1 - 104