Polymerase Chain Reaction

Polymerase Chain Reaction-related patent applications - as published by the U.S. Patent and Trademark Office (USPTO).

Image View Download All PDFs List View Archive

loading
Restriction mediated quantitative polymerase chain reactions
Multiplicom N.v.
May 18, 2017 - N°20170137865

The present invention relates to the technical field of nucleic acid amplification using a polymerase chain reaction (pcr). Specifically, the present invention relates to polymerase chain reaction (pcr) primers and polymerase chain reaction (pcr) nucleic acid amplification mixture and the use thereof in (quantitative) polymerase chain reactions (pcr). Specifically, the present invention relates to polymerase chain reaction (pcr) primers suitable ...
Polymerization of nucleic acids using proteins having low isoelectric points
Life Technologies Corporation
April 27, 2017 - N°20170114391

This disclosure relates to the use of one or more proteins (e. G., globular proteins) having a low isoelectric point and/or a limited number (e. G., zero) of modifying groups in nucleic acid polymerization and/or amplification reactions such as polymerase chain reaction (pcr).
Method for obtaining immunoglobulin encoding nucleic acid
Life Technologies Corporation
April 20, 2017 - N°20170107550

Whereby the distance of the binding locations of the primer employed in the second polymerase chain reaction is reduced compared to the first polymerase chain reaction.
Polymerase Chain Reaction Patent Pack
Download + patent application PDFs
Polymerase Chain Reaction Patent Applications
Download + Polymerase Chain Reaction-related PDFs
For professional research & prior art discovery
inventor
  • + full patent PDF documents of Polymerase Chain Reaction-related inventions.
  • Exact USPTO filing data with full-text, images, drawings & claims.
  • Index pages: Table View and Image-Grid View layouts. All images in each PDF.
Multiplex q-pcr arrays
California Institute Of Technology
March 23, 2017 - N°20170081714

This invention provides methods and systems for measuring the concentration of multiple nucleic acid sequences in a sample. The nucleic acid sequences in the sample are simultaneously amplified, for example, using polymerase chain reaction (pcr) in the presence of an array of nucleic acid probes. The amount of amplicon corresponding to the multiple nucleic acid sequences can be measured in ...
Microfluidic analysis system
Stokes Bio Limited
March 23, 2017 - N°20170081705

A microfluidic analysis system (1) performs polymerase chain reaction (pcr) analysis on a bio sample. In a centrifuge (6) the sample is separated into dna and rna constituents. The vortex is created by opposing flow of a silicon oil primary carrier fluid effecting circulation by viscous drag. The bio sample exits the centrifuge enveloped in the primary carrier fluid. This is pumped ...
Method and kit of parts for extraction of nucleic acids
Ifp Privates Institut Fur Produktqualitat Gmbh
March 23, 2017 - N°20170081704

Composition, method and kit of parts for a simplified and safe extraction of nucleic acids from biological samples, such as crude and processed food, and subsequent analysis by polymerase chain reaction to the presence of animal material, genetically modified organisms, allergens and pathogens. The method comprises the addition of extracting composition together with hot water for extraction and stabilization of ...
Polymerase Chain Reaction Patent Pack
Download + patent application PDFs
Polymerase Chain Reaction Patent Applications
Download + Polymerase Chain Reaction-related PDFs
For professional research & prior art discovery
inventor
  • + full patent PDF documents of Polymerase Chain Reaction-related inventions.
  • Exact USPTO filing data with full-text, images, drawings & claims.
  • Index pages: Table View and Image-Grid View layouts. All images in each PDF.
Method for reduction or elimination of false-negative enzyme immunoassay and polymerase chain reaction testing results
Luminex Corporation
March 16, 2017 - N°20170073779

Methods and techniques to increase the reliability of detecting virus infections, particularly lymphotropism, to eliminate false negative reactions in testing blood for the presence of lymphotropic viruses during enzyme immunoassay (eia) and polymerase chain reaction (pcr) testing, and to better detect viruses with lymphotropism in biological materials having a concentration of virus particles lower than the sensitivity threshold of existing ...
Development of novel detergents for use in pcr systems
Life Technologies Corporation
March 16, 2017 - N°20170073746

This disclosure relates to novel detergents for use in various procedures including, for example, nucleic acid amplification reactions such as polymerase chain reaction (pcr). Methods for preparing the modified detergents are also described.
Nucleic acid amplificiation techniques and methods for detecting bacterial infection
Board Of Regents, The University Of Texas System
March 16, 2017 - N°20170073736

Sequence specific dna amplification and analysis techniques are provided. In some aspects, methods of the embodiments comprise amplifying sequence from two regions of a target sequence in the presence of a blocking oligonucleotide (e. G., such as a phosphorothioate-containing oligonucleotide) that hybridizes to the target sequence between the two regions. In some specific embodiments, a method is provided for detecting ...
Pc board fluidic devices
California Institute Of Technology
March 16, 2017 - N°20170072399

Pc board fluidic devices for performing a polymerase chain reaction (pcr) are disclosed. The devices comprise a printed circuit board and a pcr chamber. The pcr chamber is a fluidic chamber and is located in, or is part of, the pc board. The pc board can include a coil trace heating element with a temperature sensor and controller.
Methods and kits for sequencing and characterizing protozoa
Fry Laboratories, Llc
March 02, 2017 - N°20170058364

Disclosed are compositions, kits, and methods for detecting, characterizing, and/or identifying one or more protozoa. Various types of polymerase chain reaction techniques in connection with specifically designed primers can be used to detect a variety of, e. G., pathogenic, protozoa in samples.
Field pathogen identification
Bg Research Ltd
March 02, 2017 - N°20170056879

A process for the identification of genetic material in a biological liquid sample and including the steps of injecting into a reaction vessel containing freeze dried pcr reagents and labelled primers sufficient pure water to liquify the reagents and primers; injecting the biological liquid sample into the reaction vessel; subjecting the reaction vessel contents to a cell disruption process, in ...
Primers and methods for nucleic acid amplification
Ohio State Innovation Foundation
February 23, 2017 - N°20170051005

A primer and method for amplification of a target nucleic acid, the primer adapted to conform into a conformation that dissociates from a complementary strand of dna duplex. The conformation may have a free energy with more favorable thermodynamics than a corresponding dna duplex, such as a b-dna duplex. The dissociation may occur during an extension step of an amplification ...
Polymerase Chain Reaction Patent Pack
Download + patent application PDFs
Polymerase Chain Reaction Patent Applications
Download + Polymerase Chain Reaction-related PDFs
For professional research & prior art discovery
inventor
  • + full patent PDF documents of Polymerase Chain Reaction-related inventions.
  • Exact USPTO filing data with full-text, images, drawings & claims.
  • Index pages: Table View and Image-Grid View layouts. All images in each PDF.
Polymerase chain reaction device and polymerase chain reaction method
Seiko Epson Corporation
February 16, 2017 - N°20170043344

A pcr device, in which a vessel is filled with a liquid which has a lower specific gravity than a reaction mixture and is immiscible with the reaction mixture, and a control section drives and controls a first heating section and a second heating section so that the liquid in an upper part in the vessel is brought to a ...
Microchannel chip, pcr method, and heating/cooling control apparatus
Panasonic Intellectual Property Management Co., Ltd.
February 02, 2017 - N°20170028402

A method for performing a polymerase chain reaction (pcr) process on a treatment target liquid using a microchannel chip and a heating/cooling control apparatus is provided. The microchannel chip includes: a first substrate layer that has an introducing channel and a discharging channel; and a second substrate layer that is disposed on the first substrate layer and has a ...
Thermal control device and methods of use
Cepheid
January 26, 2017 - N°20170023281

Thermal control devices adapted to provide improved control and efficiency in temperature cycling are provided herein. Such thermal control device can include a thermoelectric cooler controlled in coordination with another thermal manipulation device to control an opposing face of the thermoelectric cooler and/or a microenvironment. Some such thermal control devices include a first and second thermoelectric cooler separated by ...
Apparatus and method for electrical detection of oligonucleotides through pore blockades
The Regents Of The University Of California
January 19, 2017 - N°20170016877

Systems and methods for specific nucleic acid (na) sequence detection that do not rely on polymerase chain reaction (pcr) for target sequence amplification and do not require any special reagents other than a complementary sequence capture probe conjugated to spherical beads.
Method for reducing primer-dimer amplification
Pillar Biosciences Inc.
January 12, 2017 - N°20170009281

The present invention reduces primer-dimer amplification in a multiplex polymerase chain reaction (pcr). When a first forward primer (f1) and a second reverse primer (r2) have a complementary region at their 3′ends, primer dimers may form. The present method uses a primer comprising a 5′-end partial sequence or a full sequence of a first forward primer (f1̂) ...
Detection kit for identifying genotype in depression patients and method of using the same
Pillar Biosciences Inc.
December 22, 2016 - N°20160369341

The present invention relates to a rs6311 test kit, which includes a probe, a primer, and a polymerase chain reaction solution, wherein said probe sequence is as follows: rs6311t-fam: ctgtgagtgtctggc (seq. Id. No. 1) and rs6311c-vic: ctgtgagtgtccggc (seq. Id. No. 2); and said primer sequence is as follows: rs6311-f: agagagaacataaataaggctagaaaacagta (seq. Id. No. 3) and rs6311-r: cactgttggctttggatgga (seq. Id. ...
Method for evaluation of viability of viruses with lymphotropism properties
Pillar Biosciences Inc.
December 22, 2016 - N°20160369325

Methods and techniques to increase the reliability of detecting virus infections, particularly lymphotropism, to eliminate false negative reactions in testing blood for the presence of lymphotropic viruses during enzyme immunoassay (eia) and polymerase chain reaction (pcr) testing, and to better detect viruses with lymphotropism in biological materials having a concentration of virus particles lower than the sensitivity threshold of existing ...
Camera imaging system for a fluid sample assay and method of using same
Fluxergy, Llc
December 22, 2016 - N°20160369324

Apparatuses and for causing a point-of-care polymerase chain reaction and analyzing the polymerase chain reaction at the point-of-care, particularly when unwanted bubbles are present during the polymerase chain reaction, are described herein. In a general embodiment, a device for analysing a polymerase chain reaction in a fluid sample includes a current source configured to cause the polymerase chain reaction by ...