Images List Premium Download Classic

Polymerase Chain Reaction

Polymerase Chain Reaction-related patent applications - as published by the U.S. Patent and Trademark Office (USPTO).


loading
Methods for detecting nucleic acid fragments
Bio-id Diagnostic Inc.
June 15, 2017 - N°20170166954

Provided are methods for detecting and analyzing polynucleotides in a biological sample or sample derived therefrom for example, using a synthetic template polynucleotide. In some aspects, a target polynucleotide in the sample hybridizes to the template polynucleotide and is extended by a polymerase, generating an extended target polynucleotide. In some examples, the extended target polynucleotide is amplified, for example, by ...
Restriction mediated quantitative polymerase chain reactions
Multiplicom N.v.
May 18, 2017 - N°20170137865

The present invention relates to the technical field of nucleic acid amplification using a polymerase chain reaction (pcr). Specifically, the present invention relates to polymerase chain reaction (pcr) primers and polymerase chain reaction (pcr) nucleic acid amplification mixture and the use thereof in (quantitative) polymerase chain reactions (pcr). Specifically, the present invention relates to polymerase chain reaction (pcr) primers suitable ...
Polymerization of nucleic acids using proteins having low isoelectric points
Life Technologies Corporation
April 27, 2017 - N°20170114391

This disclosure relates to the use of one or more proteins (e. G., globular proteins) having a low isoelectric point and/or a limited number (e. G., zero) of modifying groups in nucleic acid polymerization and/or amplification reactions such as polymerase chain reaction (pcr).
Polymerase Chain Reaction Patent Pack
Download + patent application PDFs
Polymerase Chain Reaction Patent Applications
Download + Polymerase Chain Reaction-related PDFs
For professional research & prior art discovery
inventor
  • + full patent PDF documents of Polymerase Chain Reaction-related inventions.
  • Exact USPTO filing data with full-text, images, drawings & claims.
  • Index pages: Table View and Image-Grid View layouts. All images in each PDF.
Method for detecting guanine-abasic site in dna
Life Technologies Corporation
March 30, 2017 - N°20170088884

(3) step 3 of performing polymerase chain reaction on the modified double-stranded dna obtained by conducting step 1 and step 2, which serves as a template, to search for the presence or absence of an amplification product, the sequence of steps 1 and 2 being not limited to the order presented.
Multiplex q-pcr arrays
California Institute Of Technology
March 23, 2017 - N°20170081714

This invention provides methods and systems for measuring the concentration of multiple nucleic acid sequences in a sample. The nucleic acid sequences in the sample are simultaneously amplified, for example, using polymerase chain reaction (pcr) in the presence of an array of nucleic acid probes. The amount of amplicon corresponding to the multiple nucleic acid sequences can be measured in ...
Microfluidic analysis system
Stokes Bio Limited
March 23, 2017 - N°20170081705

A microfluidic analysis system (1) performs polymerase chain reaction (pcr) analysis on a bio sample. In a centrifuge (6) the sample is separated into dna and rna constituents. The vortex is created by opposing flow of a silicon oil primary carrier fluid effecting circulation by viscous drag. The bio sample exits the centrifuge enveloped in the primary carrier fluid. This is pumped ...
Polymerase Chain Reaction Patent Pack
Download + patent application PDFs
Polymerase Chain Reaction Patent Applications
Download + Polymerase Chain Reaction-related PDFs
For professional research & prior art discovery
inventor
  • + full patent PDF documents of Polymerase Chain Reaction-related inventions.
  • Exact USPTO filing data with full-text, images, drawings & claims.
  • Index pages: Table View and Image-Grid View layouts. All images in each PDF.
Apparatus and methods for integrated sample preparation, reaction and detection
Luminex Corporation
March 23, 2017 - N°20170080427

Cartridges for the isolation of a biological sample and downstream biological assays on the sample are provided, as are methods for using such cartridges. In one embodiment, a nucleic acid sample is isolated from a biological sample and the nucleic acid sample is amplified, for example by the polymerase chain reaction. The cartridges provided herein can also be used for ...
Method for reduction or elimination of false-negative enzyme immunoassay and polymerase chain reaction testing results
Luminex Corporation
March 16, 2017 - N°20170073779

Methods and techniques to increase the reliability of detecting virus infections, particularly lymphotropism, to eliminate false negative reactions in testing blood for the presence of lymphotropic viruses during enzyme immunoassay (eia) and polymerase chain reaction (pcr) testing, and to better detect viruses with lymphotropism in biological materials having a concentration of virus particles lower than the sensitivity threshold of existing ...
Development of novel detergents for use in pcr systems
Life Technologies Corporation
March 16, 2017 - N°20170073746

This disclosure relates to novel detergents for use in various procedures including, for example, nucleic acid amplification reactions such as polymerase chain reaction (pcr). Methods for preparing the modified detergents are also described.
Nucleic acid amplificiation techniques and methods for detecting bacterial infection
Board Of Regents, The University Of Texas System
March 16, 2017 - N°20170073736

Sequence specific dna amplification and analysis techniques are provided. In some aspects, methods of the embodiments comprise amplifying sequence from two regions of a target sequence in the presence of a blocking oligonucleotide (e. G., such as a phosphorothioate-containing oligonucleotide) that hybridizes to the target sequence between the two regions. In some specific embodiments, a method is provided for detecting ...
Pc board fluidic devices
California Institute Of Technology
March 16, 2017 - N°20170072399

Pc board fluidic devices for performing a polymerase chain reaction (pcr) are disclosed. The devices comprise a printed circuit board and a pcr chamber. The pcr chamber is a fluidic chamber and is located in, or is part of, the pc board. The pc board can include a coil trace heating element with a temperature sensor and controller.
Methods and kits for sequencing and characterizing protozoa
Fry Laboratories, Llc
March 02, 2017 - N°20170058364

Disclosed are compositions, kits, and methods for detecting, characterizing, and/or identifying one or more protozoa. Various types of polymerase chain reaction techniques in connection with specifically designed primers can be used to detect a variety of, e. G., pathogenic, protozoa in samples.
Field pathogen identification
Bg Research Ltd
March 02, 2017 - N°20170056879

A process for the identification of genetic material in a biological liquid sample and including the steps of injecting into a reaction vessel containing freeze dried pcr reagents and labelled primers sufficient pure water to liquify the reagents and primers; injecting the biological liquid sample into the reaction vessel; subjecting the reaction vessel contents to a cell disruption process, in ...
Polymerase Chain Reaction Patent Pack
Download + patent application PDFs
Polymerase Chain Reaction Patent Applications
Download + Polymerase Chain Reaction-related PDFs
For professional research & prior art discovery
inventor
  • + full patent PDF documents of Polymerase Chain Reaction-related inventions.
  • Exact USPTO filing data with full-text, images, drawings & claims.
  • Index pages: Table View and Image-Grid View layouts. All images in each PDF.
Methods for temperature-mediated nested polymerase chain reaction
Tetracore, Inc.
February 16, 2017 - N°20170044585

Embodiments of present disclosure are directed to methods for amplifying nucleic acid, comprising two steps: a first step of preparing a reaction mixture comprising the target nucleic acid and a second step of processing the reaction mixture in a thermocycler. During a first phase of the processing step, the thermocycler may be configured to heat the reaction mixture to a ...
Polymerase chain reaction device and polymerase chain reaction method
Seiko Epson Corporation
February 16, 2017 - N°20170043344

A pcr device, in which a vessel is filled with a liquid which has a lower specific gravity than a reaction mixture and is immiscible with the reaction mixture, and a control section drives and controls a first heating section and a second heating section so that the liquid in an upper part in the vessel is brought to a ...
Microchannel chip, pcr method, and heating/cooling control apparatus
Panasonic Intellectual Property Management Co., Ltd.
February 02, 2017 - N°20170028402

A method for performing a polymerase chain reaction (pcr) process on a treatment target liquid using a microchannel chip and a heating/cooling control apparatus is provided. The microchannel chip includes: a first substrate layer that has an introducing channel and a discharging channel; and a second substrate layer that is disposed on the first substrate layer and has a ...
Thermal control device and methods of use
Cepheid
January 26, 2017 - N°20170023281

Thermal control devices adapted to provide improved control and efficiency in temperature cycling are provided herein. Such thermal control device can include a thermoelectric cooler controlled in coordination with another thermal manipulation device to control an opposing face of the thermoelectric cooler and/or a microenvironment. Some such thermal control devices include a first and second thermoelectric cooler separated by ...
Apparatus and method for electrical detection of oligonucleotides through pore blockades
The Regents Of The University Of California
January 19, 2017 - N°20170016877

Systems and methods for specific nucleic acid (na) sequence detection that do not rely on polymerase chain reaction (pcr) for target sequence amplification and do not require any special reagents other than a complementary sequence capture probe conjugated to spherical beads.
Method for reducing primer-dimer amplification
Pillar Biosciences Inc.
January 12, 2017 - N°20170009281

The present invention reduces primer-dimer amplification in a multiplex polymerase chain reaction (pcr). When a first forward primer (f1) and a second reverse primer (r2) have a complementary region at their 3′ends, primer dimers may form. The present method uses a primer comprising a 5′-end partial sequence or a full sequence of a first forward primer (f1̂) ...
Detection kit for identifying genotype in depression patients and method of using the same
Pillar Biosciences Inc.
December 22, 2016 - N°20160369341

The present invention relates to a rs6311 test kit, which includes a probe, a primer, and a polymerase chain reaction solution, wherein said probe sequence is as follows: rs6311t-fam: ctgtgagtgtctggc (seq. Id. No. 1) and rs6311c-vic: ctgtgagtgtccggc (seq. Id. No. 2); and said primer sequence is as follows: rs6311-f: agagagaacataaataaggctagaaaacagta (seq. Id. No. 3) and rs6311-r: cactgttggctttggatgga (seq. Id. ...
Method for evaluation of viability of viruses with lymphotropism properties
Pillar Biosciences Inc.
December 22, 2016 - N°20160369325

Methods and techniques to increase the reliability of detecting virus infections, particularly lymphotropism, to eliminate false negative reactions in testing blood for the presence of lymphotropic viruses during enzyme immunoassay (eia) and polymerase chain reaction (pcr) testing, and to better detect viruses with lymphotropism in biological materials having a concentration of virus particles lower than the sensitivity threshold of existing ...
Loading