FreshPatents.com Logo
Enter keywords:  

Track companies' patents here: Public Companies RSS Feeds | RSS Feed Home Page
Popular terms

[SEARCH]

Follow us on Twitter
twitter icon@FreshPatents

Web & Computing
Cloud Computing
Ecommerce
Search patents
Smartphone patents
Social Media patents
Video patents
Website patents
Web Server
Android patents
Copyright patents
Database patents
Programming patents
Wearable Computing
Webcam patents

Web Companies
Apple patents
Google patents
Adobe patents
Ebay patents
Oracle patents
Yahoo patents

[SEARCH]

Nucleotide patents



      
           
This page is updated frequently with new Nucleotide-related patent applications. Subscribe to the Nucleotide RSS feed to automatically get the update: related Nucleotide RSS feeds. RSS updates for this page: Nucleotide RSS RSS


Methods for expanding color palette in dendrobium orchids

Polynucleotides and polypeptides that confer increased yield, size or biomass

Date/App# patent app List of recent Nucleotide-related patents
07/17/14
20140201871
 Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same patent thumbnailPolypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same
The present invention relates to isolated polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides..
07/17/14
20140201865
 Methods for expanding color palette in dendrobium orchids patent thumbnailMethods for expanding color palette in dendrobium orchids
A nucleotide sequence encoding flavonoid 3′-hydroxylase (f3′h) of dendrobium, a method of producing a transgenic flower color-changed dendrobium plant, and a transgenic flower color-changed dendrobium plant are provided by this invention.. .
07/17/14
20140201864
 Polynucleotides and polypeptides in plants patent thumbnailPolynucleotides and polypeptides in plants
The invention relates to plant transcription factor polypeptides, polynucleotides that encode them, homologs from a variety of plant species, and methods of using the polynucleotides and polypeptides to produce transgenic plants having advantageous properties compared to a reference plant. Sequence information related to these polynucleotides and polypeptides can also be used in bioinformatic search methods and is also disclosed..
07/17/14
20140201861
 Polynucleotides and polypeptides that confer increased yield, size or biomass patent thumbnailPolynucleotides and polypeptides that confer increased yield, size or biomass
The present description relates to plant transcription factor polypeptides, polynucleotides that encode them, homologs from a variety of plant species, and methods of using the polynucleotides and polypeptides to produce transgenic plants having advantageous properties compared to a reference plant, including the traits of increased yield, size or biomass.. .
07/17/14
20140200338
 Oligonucleotides containing high concentrations of guanine monomers patent thumbnailOligonucleotides containing high concentrations of guanine monomers
This invention pertains to methods for oligonucleotide synthesis, specifically the synthesis of oligonucleotides that contain a high content of guanine monomers. In more detail, the invention relates to a method for coupling a nucleoside phosphoramidite during the synthesis of an oligonucleotide to a universal support, to a first nucleoside, or to an extending oligonucleotide.
07/17/14
20140200264
 Modified polynucleotides for treating carboxypeptidase n, polypeptide 1 protein deficiency patent thumbnailModified polynucleotides for treating carboxypeptidase n, polypeptide 1 protein deficiency
The invention relates to compositions and methods for the preparation, manufacture and therapeutic use of polynucleotides, primary transcripts and mmrna molecules.. .
07/17/14
20140200263
 Modified polynucleotides for treating galactosidase, alpha protein deficiency patent thumbnailModified polynucleotides for treating galactosidase, alpha protein deficiency
The invention relates to compositions and methods for the preparation, manufacture and therapeutic use of polynucleotides, primary transcripts and mmrna molecules.. .
07/17/14
20140200262
 Modified polynucleotides for the production of proteins associated with blood and lymphatic disorders patent thumbnailModified polynucleotides for the production of proteins associated with blood and lymphatic disorders
The invention relates to compositions and methods for the preparation, manufacture and therapeutic use of polynucleotides, primary transcripts and mmrna molecules.. .
07/17/14
20140200261
 Signal-sensor polynucleotides for the alteration of cellular phenotypes patent thumbnailSignal-sensor polynucleotides for the alteration of cellular phenotypes
The invention relates to compositions and methods for the preparation, manufacture and therapeutic use of signal-sensor polynucleotides, primary transcripts and mmrna molecules.. .
07/17/14
20140200161
 Method of preparing an adduct patent thumbnailMethod of preparing an adduct
A method for identifying one or several molecular structure(s) having a high-affinity for a target of interest, the molecular structure(s) each including one nucleotide chain onto which is hybridized at least one pna-encoded molecule.. .
07/17/14
20140199762
Immunotherapeutic methods using epitopes of wt-1 and gata-1
A peptide comprising the amino acid sequence rmfpnapyl or a portion or variant thereof provided that the peptide is not intact human wt-1 polypeptide or a peptide comprising the amino acid sequence cmtwnqmnl or a portion or variant thereof provided that the peptide is not intact human wt-1 polypeptide or a peptide comprising the amino acid sequence hlmpfpgpll or a portion or variant thereof provided that the peptide is not intact human gata-1 polypeptide, and polynucleotides encoding these peptides. The peptides and polynucleotides are useful as cancer vaccines..
07/17/14
20140199760
Plants having enhanced abiotic stress resistance
Means are provided of increasing the growth potential and abiotic stress resistance in plants, characterized by expression of polynucleotides stably integrated into a plant genome or stably incorporated in the plant. Further provided are isolated nucleic acids and their stable inclusion in transgenic plants.
07/17/14
20140199705
Glucanases, nucleic acids encoding them and methods for making and using them
The invention relates to polypeptides having glucanase, e.g., endoglucanase, mannanase, xylanase activity or a combination of these activities, and polynucleotides encoding them. In one aspect, the glucanase activity is an endoglucanase activity (e.g., endo-1,4-beta-d-glucan 4-glucano hydrolase activity) and comprises hydrolysis of 1,4-beta-d-glycosidic linkages in cellulose, cellulose derivatives (e.g., carboxy methyl cellulose and hydroxy ethyl cellulose) lichenin, beta-1,4 bonds in mixed beta-1,3 glucans, such as cereal beta-d-glucans or xyloglucans and other plant material containing cellulosic parts.
07/17/14
20140199691
Methods of fetal abnormality detection
Methods and kits for selectively enriching non-random polynucleotide sequences are provided. Methods and kits for generating libraries of sequences are provided.
07/17/14
20140199688
Conditionallly replication-competent adenovirus
The present invention provides a polynucleotide, which comprises human telomerase reverse transcriptase (htert) promoter, e1a gene, ires sequence and e1b gene in this order and which comprises a target sequence of a first mirna. The present invention also provides a recombinant adenovirus, which comprises a replication cassette comprising the above polynucleotide, wherein the replication cassette is integrated into the e1 region of the adenovirus genome..
07/17/14
20140199687
Nucleic acid sequences that can be used as primers and probes in the amplification and detection of all subtypes of hiv-1
The present invention is related to nucleic acid sequences that can be used in the field of virus diagnostics, more specifically the diagnosis of infections with the aids causing human immuno-deficiency virus (hiv). With the present invention nucleotide sequences are provided that can be used as primers and probes in the amplification and detection of hiv-1 nucleic acid.
07/17/14
20140199684
Methods for amplifying hepatitis c virus nucleic acids
A method of amplifying an hcv nucleic acid in an hcv infected sample comprises amplifying a segment of a dna template that is complementary to a genome of hcv rna from the sample by a two-stage pcr, wherein a first stage pcr employs a first outer primer and a second outer primer, and a second stage pcr employs a first inner primer and a second inner primer. The nucleotide sequence of the first outer primer comprises a nucleotide sequence as set forth in seq id no: 2; or seq id no:9, wherein optionally 1, 2 or 3 nucleotides are other nucleotides than those of seq id no: 9.
07/17/14
20140199402
Novel compounds for the treatment of inflammatory bowel disease
The present invention relates to a nucleic acid molecule of up to 150 nucleotides comprising consecutively from 5′ to 3′ (a) a first part whose sequence is between 50% and 100% complementary to the sequence aaaagcuggguugagagggcga; (b) a second part capable of forming a loop between the first and the third part; and (c) a third part comprising or consisting of the sequence aaaagcuggguugagagggcga; for use as a medicament. The present invention further relates to a nucleic acid molecule of up to 25 nucleotides comprising the sequence aaaagcuggguugagagggcga, for use as a medicament.
07/17/14
20140199379
Compositions having means for targeting at least one antigen to dendritic cells
A composition that can be used as a vaccine containing means for targeting at least one antigen to dendritic cells and as adjuvants a granulocyte macrophage colony stimulating factor and a cpg oligodeoxynucleotide and/or a cpg-like oligodeoxynucleotide. This composition can used to treat cancers, infectious diseases caused by bacterial, viral, fungal, parasitic or protozoan infections, allergies and/or autoimmune diseases..
07/17/14
20140199371
Modified polynucleotides encoding basic helix-loop-helix family, member e41
The invention relates to compositions and methods for the preparation, manufacture and therapeutic use of polynucleotides, primary transcripts and mmrna molecules.. .
07/17/14
20140199345
Immunostimulatory oligodeoxynucleotides
The present invention relates to immunostimulatory oligodeoxynucleotides, vectors and vaccines comprising such oligodeoxynucleotides, to their use as a medicament, to their use in preventing or combating infectious disease, to methods for the detection of such oligodeoxynucleotides and to cells to be used in these methods.. .
07/17/14
20140199343
Recombinant vaccine against prrs in a viral vector
A live or inactivated recombinant vaccine is described, comprising a viral vector and a pharmaceutically acceptable vehicle, adjuvant and/or excipient, wherein the viral vector is capable of generating a cell immune response due to an increased alpha and/or gamma interferon production, and is capable of a quick replication, and it has inserted a nucleotide sequence of the orf 5 and orf 6 from prss.. .
07/17/14
20140199332
Method of treating cancer with an hla-a*3303-restricted wt1 peptide and pharmaceutical composition comprising the same
Disclosed are: a peptide comprising an amino acid sequence composed of contiguous nine amino acid residues derived from a wt1 protein, wherein an amino acid residue at position 2 in the amino acid sequence is selected from the group consisting of ala, ile, leu, val, phe, tyr, ser and asp and an amino acid residue at position 9 in the amino acid sequence is arg; a polynucleotide encoding the peptide; a pharmaceutical composition comprising the peptide; and a method of treating cancer using the peptide.. .
07/17/14
20140199320
Modulators of the nlrp3 inflammasome il-1beta pathway for the prevention and treatment of acne
The invention provides inhibitors capable of binding to a member of the inflammasome group comprised of il-1β, il-1 receptor type 1, nlrp3, asc, caspase-1 and cathepsin b with a dissociation constant of 10-8 mol/l or smaller for the prevention and treatment of acne, specifically an antibody, an antibody fragment, an antibody-like molecule, an oligopeptide of 6 to 30 amino acid residues, a nucleic acid aptamer molecule of 10 to 75 nucleotides in length or a soluble polypeptide comprising a contiguous amino acid sequence of at least 30 amino acids comprised within the protein sequence of a member of the group comprised of il-1β, il-1 receptor type 1, il-1 receptor type 2, nlrp3, asc and caspase-1. Similarly, an interfering rna or an antisense modulator of gene expression of il-1β, i l-1β receptor type 1, nlrp3, asc, caspase-1 and cathepsin b are provided for the prevention or treatment of acne..
07/17/14
20140199316
Methods of treating complications and disorders associated with g-csf administration
The present embodiments relate to novel uses of mpo inhibitors and inhibitors of mpo and e-selectin binding. In some embodiments, methods are provided for treating g-csf-induced vascular complications and associate tissue injury comprising administering to a subject in need thereof a compound that inhibits e-selectin receptor/ligand interaction or inhibits mpo activity.
07/17/14
20140199268
Variants of hepatitis b virus with resistance to anti-viral nucleoside agents and applications thereof
The present invention relates generally to viral variants exhibiting reduced sensitivity to particular agents and/or reduced interactivity with immunological reagents. More particularly, the present invention is directed to hepatitis b virus (hbv) variants exhibiting complete or partial resistance to nucleoside or nucleotide analogs and/or reduced interactivity with antibodies to viral surface components including reduced sensitivity to these antibodies.
07/17/14
20140199245
Oligonucleotide-based probes for detection of bacterial nucleases
The present invention relates to a rapid detection of microbial-associated nuclease activity with chemically modified nuclease (e.g., ribonuclease) substrates, and probes and compositions useful in detection assays. Accordingly, in certain embodiments, the present invention provides a probe for detecting a microbial endonuclease comprising a substrate oligonucleotide of 2-30 nucleotides in length, a fluorescence-reporter group operably linked to the oligonucleotide, and a fluorescence-quencher group operably linked to the oligonucleotide.
07/10/14
20140196177
Acyl-coa: diacylglycerol acyltransferase 1-like gene (ptdgat1) and uses thereof
An isolated protein which is at least partially encoded by a polynucleotide sequence encoding a novel acyl-coa: diacylglycerol acyltransferase 1—like gene (ptdgat1) from the diatom phaeodactylum tricomutum is provided together with a composition which includes the isolated protein and a transgenic organism transformed by a polynucleotide encoding same. The invention also provides a method for producing or enhancing the production of oil or triacylglycerols with high saturated fatty acids content..
07/10/14
20140196176
Method for isolating cell-type specific mrnas
The invention provides methods for isolating cell-type specific mrnas by selectively isolating ribosomes or proteins that bind mrna in a cell type specific manner, and, thereby, the mrna hound to the ribosomes or proteins that bind mrna. Ribosomes, which are riboprotein complexes, bind mrna that is being actively translated in cells.
07/10/14
20140196175
Axmi221z, axmi222z, axmi223z, axmi224z and axmi225z delta-endotoxin genes and methods for their use
Compositions and methods for conferring pesticidal activity to bacteria, plants, plant cells, tissues and seeds are provided. Compositions comprising a coding sequence for a toxin polypeptide are provided.
07/10/14
20140196173
Plants having altered agronomic characteristics under nitrogen limiting conditions and related constructs and methods involving genes encoding lnt6 polypeptides and homologs thereof
Isolated polynucleotides and polypeptides and recombinant dna constructs particularly useful for altering agronomic characteristics of plants under nitrogen limiting conditions, compositions (such as plants or seeds) comprising these recombinant dna constructs, and methods utilizing these recombinant dna constructs. The recombinant dna construct comprises a polynucleotide operably linked to a promoter functional in a plant, wherein said polynucleotide encodes an lnt6 polypeptide or homolog thereof..
07/10/14
20140196171
Plant promoters induced by hydrological shortage and use thereof
A nucleotide promoter sequence permits regulation of gene expression in plants including at least 80% of identity with sequence or a portion of promoter sequence of genes atlg05340 or atlg80160 of arabidopsis. A method obtains a plant genetically modified with such a promoter nucleotide sequence and a method obtains promoter regions of genes atlg05340 or atlg80160 of arabidopsis..
07/10/14
20140196166
Terpene synthases from santalum
An isolated nucleic acid molecule that encodes a terpene synthase and is selected from among: a) a nucleic acid molecule comprising the sequence of nucleotides set forth in seq id no: 1, seq id no: 3 or seq id no: 5; b) a nucleic acid molecule that is a fragment of (a); c) a nucleic acid molecule comprising a sequence of nucleotides that is complementary to (a) or (b); and d) a nucleic acid molecule that encodes a terpene synthase having at least or at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity to any one of (a)-(c); wherein the nucleic acid molecule encodes a terpene synthase.. .
07/10/14
20140196162
Plant transcriptional regulators
The invention relates to plant transcription factor polypeptides, polynucleotides that encode them, homologs from a variety of plant species, and methods of using the polynucleotides and polypeptides to produce transgenic plants having improved tolerance to drought, shade, and low nitrogen conditions, as compared to wild-type or reference plants.. .
07/10/14
20140196160
Methods and means for monitoring and modulating gene silencing
Methods and means are provided for monitoring and modulating reduction of gene expression in eukaryotic organisms, using double stranded rna comprising, in addition to the dsrna region comprising nucleotide sequences homologous to the target gene, additional dsrna regions designed to down regulate a second gene or which are unrelated to the target gene.. .
07/10/14
20140195216
Computational design of ideotypically modulated pharmacoeffectors for selective cell treatment
In system and method embodiments, an embodiment includes the collection, input, and organization of target nucleotide source or sources; the identification of potential target sequences for ideotypically modulated pharmacoeffectors (imp); the exclusion, prioritization, or deprioritization of target sequences on the basis of undesirable binding for ideotypically modulated pharmacoeffectors (imp); and/or the design of targeting sequences on the basis of reverse complementarity or sequence complementarity. Imps are designed for optimal use in respective applications, including cancers, autoimmune diseases, infectious diseases, cellular diseases, and other applications..
07/10/14
20140194614
Amino-lna, thio-lna and alpha-l-oxy-ln
A novel class of pharmaceuticals which comprises a locked nucleic acid (lna) which can be used in antisense therapy. These novel oligonucleotides have improved antisense properties.
07/10/14
20140194612
Immunosuppression compound and treatment method
A method and compound for suppressing an immune response in a mammalian subject, for the treatment or prevention of an autoimmune condition or transplantation rejection are disclosed. The compound is an antisense oligonucleotide analog compound having a targeting sequence complementary to a preprocessed ctla-4 mrna region identified by seq id no: 22 in seq id no: 1, spanning the splice junction between intron 1 and exon 2 of the preprocessed mrna of the subject.
07/10/14
20140194494
Modified polynucleotides for treating protein deficiency
The invention relates to compositions and methods for the preparation, manufacture and therapeutic use of polynucleotides, primary transcripts and mmrna molecules.. .
07/10/14
20140194492
Methods for treating hypercholesterolemia
Disclosed herein are antisense compounds and methods for decreasing ldl-c in an individual having elevated ldl-c. Additionally disclosed are antisense compounds and methods for treating, preventing, or ameliorating hypercholesterolemia and/or atherosclerosis.
07/10/14
20140194365
Use of endostatin peptides for the treatment of fibrosis
C-terminal endostatin polypeptides are disclosed herein. Polynucleotides encoding these polypeptide, host cells transformed with the polynucleotides, and methods of using these polypeptides and polynucleotides are disclosed.
07/10/14
20140194355
Isolated nucleic acid molecules encoding variant activin receptor polypeptides
The present invention provides variant activin iib soluble receptor polypeptides and proteins capable of binding and inhibiting the activities of activin a, myostatin, or gdf-11. The present invention also provides polynucleotides, vectors and host cells capable of producing the variant polypeptides and proteins.
07/10/14
20140194351
Hemipteran-and coleopteran active toxin proteins from bacillus thuringiensis
A novel bacillus thuringiensis crystal protein exhibiting insect inhibitory activity is disclosed. Growth of lygus insects is significantly inhibited by providing the novel crystal protein in lygus insect diet.
07/10/14
20140194323
Multitag sequencing ecogenomics analysis-us
Embodiments of the invention herein described relate to multiplex polynucleotide sequence analysis without the use of size separation methods or blotting. In certain particulars the invention relates to multiplex sequencing using massively parallel sequencing methods, such as pyrosequencing methods and sequencing by synthesis.
07/10/14
20140194322
Methods for creating and identifying functional rna interference elements
The invention relates to the control of gene expression. Specifically, the invention provides compositions and methods for the production and use of recombinant nucleic acid molecules that have the ability to specifically downregulate an expressed target gene in vivo.
07/10/14
20140194312
Complex sets of mirnas as non-invasive biomarkers for dilated cardiomyopathy
The present invention relates to non-invasive methods, kits and means for diagnosing and/or prognosing of dilated cardiomyopathy in a body fluid sample from a subject. Further, the present invention relates to set of polynucleotides or sets of primer pairs for detecting sets of mirnas for diagnosing and/or prognosing of dilated cardiomyopathy in a body fluid sample from a subject.
07/10/14
20140194311
Multiplexed proximity ligation assay
The present invention provides a method for detecting interactions between or with any two of at least three target substrates, or any two of at least three features of a target substrate, or a combination of interactions and features of target substrates, by a multiplexed proximity ligation assay, said method comprising: a) for each of the at least three target substrates or features, providing a proximity probe comprising a binding moiety with affinity for the feature or binding site on said substrate, and a proximity probe oligonucleotide coupled on the binding moiety; wherein each of the proximity probe oligonucleotide carries a unique tag sequence; b) mixing the proximity probes with a sample, under a condition to allow binding of each proximity probe to its respective binding site or feature on each of said substrates through the binding moiety, c) simultaneous with, or following step b), forming circularized dna molecules where any two proximity probes bind sufficiently close to each other on the substrate, wherein each of the circularized dna molecules comprise complementary sequences to the unique tag sequences from the two proximity probes oligo-nucleotides; d) amplifying the circularized dna; and e) characterizing the amplified dna.. .
07/10/14
20140194308
Use of myelin basic protein as a novel genetic factor for rheumatoid arthritis
A method of testing for rheumatoid arthritis, comprising detecting an autoantibody to myelin basic protein in a biological sample from a subject. A test kit for rheumatoid arthritis, comprising myelin basic protein.
07/10/14
20140194299
Compositions, methods and related uses for cleaving modified dna
Compositions, methods and related uses are provided relating to cleaving modified dna. For example, a set of dna fragments obtainable by enzymatic cleavage of a large dna is described where at least 50% are similarly sized and have a centrally positioned modified nucleotide.


Popular terms: [SEARCH]



Follow us on Twitter
twitter icon@FreshPatents

###

This listing is a sample listing of patent applications related to Nucleotide for is only meant as a recent sample of applications filed, not a comprehensive history. There may be associated servicemarks and trademarks related to these patents. Please check with patent attorney if you need further assistance or plan to use for business purposes. This patent data is also published to the public by the USPTO and available for free on their website. Note that there may be alternative spellings for Nucleotide with additional patents listed. Browse our RSS directory or Search for other possible listings.
     SHARE
  
         


FreshNews promo



0.3389

4365

0 - 1 - 90