FreshPatents.com Logo
Enter keywords:  

Track companies' patents here: Public Companies RSS Feeds | RSS Feed Home Page
Popular terms

[SEARCH]

Follow us on Twitter
twitter icon@FreshPatents

Web & Computing
Cloud Computing
Ecommerce
Search patents
Smartphone patents
Social Media patents
Video patents
Website patents
Web Server
Android patents
Copyright patents
Database patents
Programming patents
Wearable Computing
Webcam patents

Web Companies
Apple patents
Google patents
Adobe patents
Ebay patents
Oracle patents
Yahoo patents

[SEARCH]

Nucleic Acid patents



      
           
This page is updated frequently with new Nucleic Acid-related patent applications. Subscribe to the Nucleic Acid RSS feed to automatically get the update: related Nucleic RSS feeds. RSS updates for this page: Nucleic Acid RSS RSS


Date/App# patent app List of recent Nucleic Acid-related patents
07/24/14
20140208462
 Compositions, organisms, systems, and methods for expressing a gene product in plants patent thumbnailnew patent Compositions, organisms, systems, and methods for expressing a gene product in plants
The present disclosure relates, in some embodiments, to compositions, organisms, systems, and methods for expressing a gene product in a plant using a expression control sequence (ecs) operable in monocots and/or dicots. For example, (i) an isolated nucleic acid may comprise an ecs (e.g., a sugarcane bacilliform virus promoter) and, optionally, an exogenous nucleic acid (exna) operably linked to the ecs; (ii) an expression vector may comprise an ecs; an exna; and, optionally, a 3′ termination sequence, wherein the ecs has promoter activity sufficient to express the exna in at least one monocot and at least one dicot; (iii) a microorganism, plant cell, or plant may comprise an isolated nucleic acid; (iv) a method for constitutively expressing an exna in a plant (e.g., a monocot and/or a dicot) may comprise, contacting an expression vector with the cytosol of a cell of the plant, wherein the expression vector comprises the exna and an ecs operable to drive expression of the exna; and/or (v) a method of directing constitutive expression of a nucleic acid in a plant (e.g., a monocot and/or a dicot) may comprise transforming the plant with an expression nucleic acid comprising an ecs, an exna, and a 3′ termination sequence..
07/24/14
20140208461
 Defensin-encoding nucleic acid molecules derived from nicotiana alata, uses therefor and transgenic plants comprising same patent thumbnailnew patent Defensin-encoding nucleic acid molecules derived from nicotiana alata, uses therefor and transgenic plants comprising same
The present invention provides nucleic acid molecules derived from nicotiana alata, which encode defensin-like molecules. The present invention contemplates the use of such nucleic acid molecules in the generation of transgenic plants having resistance or at least reduced sensitivity to plant pests including insects, microorganisms, fungi and/or viruses and the of the encoded defensin-like molecules in compositions for topical application to a plant or a plant part so as to reduce prevent or reduce infestation of the plant or plant part by plant pests.
07/24/14
20140208457
 Nuclease fusion protein and uses thereof patent thumbnailnew patent Nuclease fusion protein and uses thereof
The present invention is concerned with nuclease fusion proteins and various uses thereof. Specifically, it relates to a polynucleotide encoding a polypeptide comprising (i) a first module comprising at least a first dna binding domain derived from a homing endonuclease, (ii) a linker, and (iii) a second module comprising at least a second dna binding domain and a cleavage domain derived from a restriction endonuclease, wherein said polypeptide functionally interacts only with dna comprising a dna recognition site for the first dna binding domain and a dna recognition site for the second dna binding domain, and wherein said cleavage domain cleaves dna within a specific dna cleavage site upon binding of the polypeptide.
07/24/14
20140208449
 Genetics of gender discrimination in date palm patent thumbnailnew patent Genetics of gender discrimination in date palm
This invention relates to the genetics of gender discrimination in the dioecious date palm. Methods of the present invention involve analyzing dna or rna from a date palm plant, tissue, germplasm, or seed for the presence of (i) a nucleic acid sequence or genotype that identifies the sex of the plant, tissue, germplasm, or seed or (ii) a molecular marker in linkage disequilibrium with the nucleic acid sequence or genotype.
07/24/14
20140206856
 Glycoside compound, method for producing thioether, ether, method for producing ether, method for producing glycoside compound, method for producing nucleic acid patent thumbnailnew patent Glycoside compound, method for producing thioether, ether, method for producing ether, method for producing glycoside compound, method for producing nucleic acid
Wherein b, r1, r2, and r3 are as described herein.. .
07/24/14
20140206851
 Proteins from the webs of nephilengys cruentata, avicularia juruensis and parawixia bistriata spiders isolated from brazilian biodiversity patent thumbnailnew patent Proteins from the webs of nephilengys cruentata, avicularia juruensis and parawixia bistriata spiders isolated from brazilian biodiversity
The present invention relates to molecules isolated from the nucleic acid that encodes spider web proteins or fragments of these or other derivatives of these. The invention also refers to a chimerical gene and an expression vector containing molecules isolated from the nucleic acid that codes for proteins related to the webs of nephilengys, cruentata, avicularia juruensis and parawixia bistriata spiders.
07/24/14
20140206838
 Compositions and methods for recognition of rna using triple helical peptide nucleic acids patent thumbnailnew patent Compositions and methods for recognition of rna using triple helical peptide nucleic acids
Peptide nucleic acids containing thymidine and 2-aminopyridine (m) nucleobases formed stable and sequence selective triple helices with double stranded rna at physiologically relevant conditions. The m-modified pna displayed unique rna selectivity by having two orders of magnitude higher affinity for the double stranded rnas than for the same dna sequences.
07/24/14
20140206777
 Methods and compositions for diagnosis of alzheimer's disease patent thumbnailnew patent Methods and compositions for diagnosis of alzheimer's disease
The invention provides a method of diagnosing alzheimer's disease (ad) in a subject by determining the level of expression of one or more mirnas molecules associated with ad, as well as various nucleic acid molecules relating thereto or derived thereof.. .
07/24/14
20140206752
 Engineered nucleic acids and methods of use thereof for non-human vertebrates patent thumbnailnew patent Engineered nucleic acids and methods of use thereof for non-human vertebrates
Provided are formulations, compositions, kits and methods for delivering biological moieties such as modified nucleic acids into cells to induce, reduce or modulate protein expression in non-human vertebrates.. .
07/24/14
20140206750
 Modulation of apolipoprotein (a) expression patent thumbnailnew patent Modulation of apolipoprotein (a) expression
Compounds, compositions and methods are provided for modulating the expression of apolipoprotein(a). The compositions comprise oligonucleotides, targeted to nucleic acid encoding apolipoprotein(a).
07/24/14
20140206747
new patent Compositions and methods for inhibiting expression of factor v
The invention relates to a double-stranded ribonucleic acid (dsrna) for inhibiting the expression of factor v, comprising an antisense strand having a nucleotide sequence which is less that 25 nucleotides in length and which is substantially complementary to at least a part of factor v. The invention also relates to a pharmaceutical composition comprising the dsrna together with a pharmaceutically acceptable carrier; methods for treating diseases caused by the expression of factor v using the pharmaceutical composition; and methods for inhibiting the expression of factor v in a cell..
07/24/14
20140206746
new patent Modulation of growth hormone receptor expression and insulin-like growth factor expression
Compounds, compositions and methods are provided for modulating the expression of growth hormone receptor and/or insulin like growth factor-i (igf-i). The compositions comprise oligonucleotides, targeted to nucleic acid encoding growth hormone receptor.
07/24/14
20140206744
new patent Rotationally sequestered translators
Provided are nucleic acid translators capable of carrying out logic operations with improved efficiency, maximized output and reduced off-target effects, in particular in a biological system. Methods of using these translators to transduce signal are also provided..
07/24/14
20140206620
new patent T cell receptors and related materials and methods of use
The invention provides t cell receptors (tcrs) having antigenic specificity for a cancer antigen, e.g., tyrosinase. Also provided are related polypeptides, proteins, nucleic acids, recombinant expression vectors, isolated host cells, populations of cells, and pharmaceutical compositions.
07/24/14
20140206594
new patent Polypeptides having protease activity and polynucleotides encoding same
The present invention relates to isolated polypeptides having protease activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides..
07/24/14
20140206578
new patent Process for determining the concentration of nucleic acids
A process is disclosed for determining the concentration of nucleic acids in a sample in a microfluidic device. In at least one embodiment, the method includes a) introducing the sample into a first chamber, b) carrying out a number of cycles of an amplification reaction to be carried out in cycles for amplifying nucleic acids, c) transferring a defined volume which is a fraction of the volume of the first chamber and which has amplified nucleic acids into a second chamber and replacing the transferred defined volume with fresh reagents for the amplification reaction, d) determining the concentration of the amplified nucleic acids in a second chamber equipped with an element to determine concentrations, and e) repeating steps b)-d) until a concentration of the amplified nucleic acids which is within a range is determined in the second chamber.
07/24/14
20140206567
new patent Method for detecting target nucleic acid
The disclosure of the present description provides a method for detecting a target nucleic acid, whereby probe hybridization can be accomplished efficiently. To that end, a target nucleic acid is amplified using a first primer having a tag sequence complementary to a detection probe pre-associated with the target nucleic acid and a first recognition sequence that recognizes a first base sequence in the target nucleic acid and also having a linking site capable of inhibiting or arresting a dna polymerase reaction disposed between the tag sequence and the first recognition sequence, and a second primer having a second recognition sequence that recognizes a second base sequence in the target nucleic acid, the amplified fragment is brought into contact with a detection probe so as to allow hybridization, and the hybridization product is detected..
07/24/14
20140206562
new patent Fabrication and use of a microfluidics multitemperature flexible reaction device
Fabrication of a microfluidic multi-temperature reaction device (mmr) and the design and fabrication of the equipment to drive various molecular biological methods on the device are provided. The device can be applicable, for example, to nucleic acid (dna, rna, cdna, etc) amplification, cell lysis, reverse transcription and other enzymatic temperature sensitive and also temperature cycling reactions..
07/24/14
20140206560
new patent Nucleic acid construct, nucleic acid-protein complex, and use thereof
Using a nucleic acid construct, association of a polypeptide with a sequence coding therefor and screening of a polypeptide that binds to a target substance are carried out, which nucleic acid construct comprises a 5′-untranslated region and a coding region, wherein the above-mentioned coding region comprises a sequence coding for a polypeptide subjected to be displayed, a sequence coding for a first nucleic acid binding polypeptide, and a sequence coding for a second nucleic acid binding polypeptide; the above-mentioned 5′-untranslated region comprises a first sequence capable of binding to a first nucleic acid binding polypeptide and a second sequence capable of binding to second nucleic acid binding polypeptide; and, when the above-mentioned nucleic acid construct is introduced in a translation system, a fusion protein translated from the coding region of the above-mentioned nucleic acid construct forms a complex with an rna corresponding to the above-mentioned nucleic acid construct.. .
07/24/14
20140206553
new patent Massive parallel method for decoding dna and rna
This invention provides methods for attaching a nucleic acid to a solid surface and for sequencing nucleic acid by detecting the identity of each nucleotide analogue after the nucleotide analogue is incorporated into a growing strand of dna in a polymerase reaction. The invention also provides nucleotide analogues which comprise unique labels attached to the nucleotide analogue through a cleavable linker, and a cleavable chemical group to cap the —oh group at the 3′-position of the deoxyribose..
07/24/14
20140206550
new patent Step-wise nucleic acid sequencing with catalytic and non-catalytic metals
The application relates to methods, and systems for nucleotide sequencing comprising producing polymerase reactions that comprise both catalytic and non-catalytic divalent metal ions. Polymerase/template/primer complexes are immobilized on a substrate.
07/24/14
20140206073
new patent Microfluidic system for nucleic acid analysis
A microfluidic system for analyzing nucleic acid, the microfluidic system including a reagent supply device including a sample chamber into which a sample can be injected, one or more reagent chambers for containing one or more reagents for extracting nucleic acid from the sample, and a waste chamber in which the used reagent can be discarded; a binding-lysis chamber in which cells are captured from the sample and lysed to form a cell lysate containing nucleic acid; plurality of particles for cell binding disposed in the binding-lysis chamber; a plurality of rehydration chambers into which the cell lysate formed in the binding-lysis chamber can be distributed and mixed with a nucleic acid amplification reagent to form an amplification reaction mixture; a plurality of amplification chambers in which a nucleic acid amplification reaction is performed on the amplification reaction mixture introduced from the plurality of rehydration chambers; and a flow channel system including an outlet and a plurality of inlets connected to the reagent supply device and forming an integrated fluid flow between the binding-lysis chamber, the rehydration chambers, and the amplification chambers.. .
07/24/14
20140206070
new patent Vector with codon-optimised genes for an arabinose metabolic pathway for arabinose conversion in yeast for ethanol production
The present invention relates to novel expression cassettes and expression vectors, comprising three nucleic acid sequences for araa, arab and arad, each coding for a polypeptide of an l-arabinose metabolic pathway, in particular, a bacterial l-arabinose metabolic pathway. The invention particularly relates to expression cassettes and expression vectors, comprising codon-optimised nucleic acid sequences for araa, arab and arad.
07/24/14
20140206059
new patent Transcriptome transfer produces cellular phenotype conversion
The present invention includes methods for effecting phenotype conversion in a cell by transfecting the cell with phenotype-converting nucleic acid. Expression of the nucleic acids results in a phenotype conversion in the transfected cell.
07/24/14
20140206037
new patent Dna vector production system
A vector production system is provided. The system comprises recombinant cells designed to encode at least a first recombinase under the control of an inducible promoter and the cells include an expression vector encoding a nucleic acid of interest within the regulatory elements of the expression vector which are flanked on either side by a target sequence for at least the first recombinase.
07/24/14
20140206035
new patent Polypeptides having glucoamylase activity and polynucleotides encoding same
Provided are isolated polypeptides having glucoamylase activity, catalytic domains, and polynucleotides encoding the polypeptides, catalytic domains. Also provided are nucleic acid constructs, vectors and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides, catalytic domains..
07/24/14
20140206026
new patent Method for screening alpha-amylases
The present invention relates to variants of a parent alpha-amylase. The present invention also relates to polynucleotides encoding the variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the variants..
07/24/14
20140206009
new patent Microfluidic device-based nucleic acid purification method
A method is provided for purifying nucleic acid from a sample in a microfluidic device. The method can be used to purify nucleic acids from any source known in the art that comprises nucleic acids, such as prokaryotic or eukaryotic organisms, viruses, cell, tissues, organs, etc.
07/24/14
20140206002
new patent Methods of diagnosing breast cancer
The disclosed subject matter is based on the discovery that a mutation (a single nucleotide polymorphism or “snp”) in the gene encoding abraxas (also referred to as abra1, ccdc98 or fam175a), is associated with susceptibility to cancer, e.g., breast cancer. In particular, the disclosed subject matter is based on the identification of a heterozygous alteration in the abraxas gene that is associated with breast cancer and specifically correlated with familial cancer.
07/24/14
20140206001
new patent Methods and compositions for enrichment of nucleic acids in mixtures of highly homologous sequences
Provided are methods of enrichment and detection of target nucleic acids during target amplification in the presence of excess amounts of highly homologous sequences, said methods having substantial diagnostic utility (e.g., cancer diagnostics). Provided are amplification reaction mixtures having at least one cleavage-directing oligonucleotide, the respective binding sites of which, for the target and homologous sequences, include one or more nucleotide positions differing in sequence between the target homologous sequences.
07/24/14
20140206000
new patent Sequence amplification with linear primers
The present disclosure relates to the amplification of target nucleic acid sequences for various sequencing and/or identification techniques. The use of these primers, as described herein, allows for the reduction in the amplification of nonspecific hybridization events (such as primer dimerization) while allowing for the amplification of the target nucleic acid sequences..
07/24/14
20140205999
new patent Compositions for detecting small rnas
Compositions and reaction mixtures are provided for the detection of small rna target nucleic acids, preferably mirna target nucleic acids, wherein the compositions and reaction mixtures provide for sensitive and specific detection of the target nucleic acids. The compositions and reaction mixtures include one or more of a first amplification oligomer that is preferably an extender primer, a target capture oligomer that is preferably at least partially double stranded, a promoter primer/provider, a reverse primer that is preferably a universal primer and a detection probe.
07/24/14
20140205632
new patent Down regulation of the gene expression by means of nucleic acid-loaded virus-like particles
The present invention relates to compositions of virus-like particles for the introduction of rna-interference (rnai-) inducing molecules into eukaryotic cells and methods for the cell type-specific transduction of a plurality of eukaryotic cells with rnai-inducing molecules. The present invention furthermore relates to methods for a diagnosis, prevention and/or treatment of diseases or disease states associated with an increased expression rate of at least one endogenous gene, and/or with the undesired expression of at least one endogenous gene and/or foreign nucleic acids, in particular viral nucleic acids..
07/24/14
20140205605
new patent Optimized antibodies that target hm1.24
The present disclosure describes antibodies that target hm1.24. In various aspects, the antibodies have specific cdr, variable, or full length sequences, have modifications with the parent antibody, or include at least one modification relative to a parent antibody that alters affinity to an fcγr or alters effector function as compared to the parent antibody.
07/24/14
20140205601
new patent Amino acid sequences directed against rank-l and polypeptides comprising the same for the treatment of bone diseases and disorders
The present invention relates to amino acid sequences that are directed against rank-l, as well as to compounds or constructs, and in particular proteins and polypeptides, that comprise or essentially consist of one or more such amino acid sequences. The invention also relates to nucleic acids encoding such amino acid sequences and polypeptides; to methods for preparing such amino acid sequences and polypeptides; to host cells expressing or capable of expressing such amino acid sequences or polypeptides; to compositions, and in particular to pharmaceutical compositions, that comprise such amino acid sequences, polypeptides, nucleic acids and/or host cells; and to uses of such amino acid sequences or polypeptides, nucleic acids, host cells and/or compositions, in particular for prophylactic, therapeutic or diagnostic purposes..
07/24/14
20140205577
new patent Treatment of cardiovascular disorders using the cell differentiation signaling protein nell1
It has been identified in accordance with the present invention that nell1 is essential for normal cardiovascular development by promoting proper formation of the heart and blood vessels. The present invention therefore provides therapeutic methods for treating cardiovascular disorders by employing a nell1 protein or nucleic acid molecule..
07/24/14
20140205576
new patent Methods and compositions for increased transgene expression
Described herein are methods of expressing nucleic acids in t cells pre-exposed to a co-stimulatory signal and then transduced with adenoviral vectors. In some embodiments, the co-stimulation is provided by anti-cd3 and anti-cd28 antibodies and the adenoviral vector is pseudotyped for t-cell entry.
07/24/14
20140205517
new patent Collecting and processing complex macromolecular mixtures
This document provides methods and materials involved in collecting and processing complex macromolecular mixtures (e.g., stool samples). For example, stool collection devices, buffers for stabilizing nucleic acid and polypeptides present in stool, and kits for using sequence-specific capture probes (e.g., nucleic acid sequences designed to hybridize with particular target nucleic acids) to capture target nucleic acids directly from complex macromolecular mixtures (e.g., stool samples) without the need to perform prior steps to enrich, isolate, or purify the nucleic acid component are provided..
07/24/14
20140202859
new patent Automated size selection of nucleic acids
Apparatus and methods for size selecting nucleic acid molecules having wide range of applications including the production of dna libraries for sequencing technologies. An automated high throughput system for size selection of multiple nucleic acid samples that uses imaging technique to detect the progress of a target fraction and feedback from the imaging to control electrophoresis.
07/17/14
20140201871
Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same
The present invention relates to isolated polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides..
07/17/14
20140201862
Compositions and methods for altering alpha- and beta-tocotrienol content
Preparation and use of isolated nucleic acids useful in altering the oil phenotype in plants. Isolated nucleic acids and their encoded polypeptides that alter alpha- and beta-tocotrienol content in seeds and oil obtained from the seeds.
07/17/14
20140201858
Methods for site-specific genetic modification in stem cells using xanthomonas tal nucleases (xtn) for the creation of model organisms
The invention relates to organisms and compositions comprising one or more stem cells or one or more embryos, wherein the one or more stem cells or one or more embryos comprise one or more of the following mutations: (i) a deletion mutation; (ii) a knockout mutation; and/or (iii) an addition of a heterologous nucleic acid sequence; wherein the one or more mutations of (i), (ii), and/or (iii) are site-specific mutations caused by a xanthomonas tal nuclease (xtn). The invention also relates to method of mutating an embryo, ips cell, stem cell, or more particularly a spermatogonial stem cell by exposing the nucleic acid sequence contained within such embryos or cell with a xanthomonas tal nuclease..
07/17/14
20140201855
Mutant luciferases
Described are mutant luciferases, nucleic acids that encode them, cells and animals expressing them, methods of use thereof, and kits.. .
07/17/14
20140200187
Cell-permeable peptide inhibitors of the jnk signal transduction pathway
The present invention refers to protein kinase inhibitors and more specifically to inhibitors of the protein kinase c-jun amino terminal kinase. Additionally, the present invention provides jnk inhibitor sequences, chimeric peptides, nucleic acids encoding same as well as pharmaceutical compositions for treating pathophysiologies associated with jnk signaling..
07/17/14
20140200163
Multiplexed genetic reporter assays and compositions
The invention provides methods for determining the activity of a plurality of nucleic acid regulatory elements. These methods may facilitate, e.g., the systematic reverse engineering, and optimization of mammalian cis-regulatory elements at high resolution and at a large scale.
07/17/14
20140200162
Method and apparatus for nucleic acid analysis
A convenient method for nucleic acid analysis is provided, which enables 1000 or more types of nucleic acid to be analyzed collectively with high comprehensiveness and with a dynamic range of at least four digits. In particular, provided is a very effective analytical method especially for untranslated rnas and micrornas, of which the types of target nucleic acids is 10000 or lower.
07/17/14
20140200147
Methods and systems for genetic analysis
This disclosure provides systems and methods for sample processing and data analysis. Sample processing may include nucleic acid sample processing and subsequent sequencing.
07/17/14
20140199767
Use
The present invention relates to the use of one or more cas genes for modulating resistance in a cell against a target nucleic acid or a transcription product thereof.. .
07/17/14
20140199761
Promoter-regulated differentiation-dependent self-deleting cassette
Targeting constructs and methods of using them are provided for differentiation-dependent modification of nucleic acid sequences in cells and in non-human animals. Targeting constructs comprising a promoter operably linked to a recombinase are provided, wherein the promoter drives transcription of the recombinase in an differentiated cell but not an undifferentiated cell.
07/17/14
20140199760
Plants having enhanced abiotic stress resistance
Means are provided of increasing the growth potential and abiotic stress resistance in plants, characterized by expression of polynucleotides stably integrated into a plant genome or stably incorporated in the plant. Further provided are isolated nucleic acids and their stable inclusion in transgenic plants.
07/17/14
20140199754
Production of itaconic acid
The invention relates to a nucleic acid sequence encoding an itaconate transporting major facilitator superfamily transporter (mfst) gene sequence and the protein encoded thereby. Preferably said sequence is the nucleic acid that comprises the sequence of ateg_09972.1 of aspergillus terreus or homologues thereof.
07/17/14
20140199705
Glucanases, nucleic acids encoding them and methods for making and using them
The invention relates to polypeptides having glucanase, e.g., endoglucanase, mannanase, xylanase activity or a combination of these activities, and polynucleotides encoding them. In one aspect, the glucanase activity is an endoglucanase activity (e.g., endo-1,4-beta-d-glucan 4-glucano hydrolase activity) and comprises hydrolysis of 1,4-beta-d-glycosidic linkages in cellulose, cellulose derivatives (e.g., carboxy methyl cellulose and hydroxy ethyl cellulose) lichenin, beta-1,4 bonds in mixed beta-1,3 glucans, such as cereal beta-d-glucans or xyloglucans and other plant material containing cellulosic parts.
07/17/14
20140199699
Compositions and methods for rt-pcr
The present invention relates to methods and compositions having trehalose and dna polymerase for facilitating the rapid and efficient amplification of nucleic acid molecules and the detection and quantitation of rna molecules, and for increasing the detection sensitivity and reliability through generation of secure cdna molecules prior to gene-specific primer dependent amplification. The reagent mixture comprises a ready to use reagent solution, wherein the solution comprises: (a) trehalose in a concentration between about 5% and about 35%; (b) a viral reverse transcriptase; and (c) at least one dna polymerases, in a buffer suitable for use in a reverse transcription reaction, wherein the buffer comprises a co-factor metal ion and nucleoside triphosphates..
07/17/14
20140199693
Method of analysing a blood sample of a subject for the presence of a disease marker
The present invention relates to a method of analysing a blood sample of a subject for the presence of a disease marker, said method comprising the steps of a) extracting nucleic acid from anucleated blood cells in said blood sample to provide an anucleated blood cells-extracted nucleic acid fraction, and b) analysing said anucleated blood cells-extracted nucleic acid fraction for the presence of a disease marker, wherein said disease marker is a disease-specific mutation in a gene of a cell of said subject, or wherein said disease marker is a disease-specific expression profile of genes of a cell of said subject.. .
07/17/14
20140199689
Method for isolating nucleic acids
The present invention pertains to a method for isolating nucleic acids from a sample, preferably a blood sample, comprising the following steps: a) obtaining a sample which has been stabilised by the use of at least one cationic detergent, wherein the cationic detergent has formed complexes with the nucleic acids; b) obtaining the complexes optionally together with other sample components from the stabilised sample, wherein said complexes comprise the nucleic acids to be isolated; c) resuspending the complexes and optionally adding one or more additives before, during and/or after resuspension, thereby obtaining a resuspended sample comprising at least: i) the nucleic acid to be isolated; ii) at least one chaotropic agent; and iii) at least one chelating agent; and d) isolating nucleic acids from the resuspended sample. It was found that adding a chelating agent during resuspension considerably increases the nucleic acid yield as the formation of precipitates which irreversibly adhere to the container wall is considerably reduced..
07/17/14
20140199687
Nucleic acid sequences that can be used as primers and probes in the amplification and detection of all subtypes of hiv-1
The present invention is related to nucleic acid sequences that can be used in the field of virus diagnostics, more specifically the diagnosis of infections with the aids causing human immuno-deficiency virus (hiv). With the present invention nucleotide sequences are provided that can be used as primers and probes in the amplification and detection of hiv-1 nucleic acid.
07/17/14
20140199686
Compositions and methods for recovery of nucleic acids or proteins from tissue samples fixed in cytology media
The present invention provides compositions and methods for improving nucleic acid or protein recovery from fixed biological samples.. .
07/17/14
20140199684
Methods for amplifying hepatitis c virus nucleic acids
A method of amplifying an hcv nucleic acid in an hcv infected sample comprises amplifying a segment of a dna template that is complementary to a genome of hcv rna from the sample by a two-stage pcr, wherein a first stage pcr employs a first outer primer and a second outer primer, and a second stage pcr employs a first inner primer and a second inner primer. The nucleotide sequence of the first outer primer comprises a nucleotide sequence as set forth in seq id no: 2; or seq id no:9, wherein optionally 1, 2 or 3 nucleotides are other nucleotides than those of seq id no: 9.
07/17/14
20140199681
Blood collection device for stabilizing cell-free rna in blood during sample shipping and storage
A method for preserving and protecting cell-free nucleic acids located within blood plasma samples is disclosed, wherein a sample of blood containing nucleic acids is treated to reduce deleterious effects of storage and transport.. .
07/17/14
20140199402
Novel compounds for the treatment of inflammatory bowel disease
The present invention relates to a nucleic acid molecule of up to 150 nucleotides comprising consecutively from 5′ to 3′ (a) a first part whose sequence is between 50% and 100% complementary to the sequence aaaagcuggguugagagggcga; (b) a second part capable of forming a loop between the first and the third part; and (c) a third part comprising or consisting of the sequence aaaagcuggguugagagggcga; for use as a medicament. The present invention further relates to a nucleic acid molecule of up to 25 nucleotides comprising the sequence aaaagcuggguugagagggcga, for use as a medicament.
07/17/14
20140199370
Cyclodextrin-based materials compositions and uses related thereto
This application discloses cyclodextrin-modified materials for carrying drugs and other active agents, such as nucleic acids. Compositions are also disclosed of cyclodextrin-modified materials that release such active agents under controlled conditions.
07/17/14
20140199336
Tmem22 peptides and vaccines including the same
Isolated peptides composed of the amino acid sequence of seq id no: 33 or fragments thereof that bind to hla antigens and have cytotoxic t lymphocyte (ctl) inducibility and thus are suitable for use in the context of cancer immunotherapy, more particularly cancer vaccines are described herein. The present invention further provides peptides that include one, two, or several amino acid insertions, substitutions or additions to the aforementioned peptides or fragments, but yet retain the requisite cytotoxic t cell inducibility.
07/17/14
20140199335
C1orf59 peptides and vaccines including the same
The present invention provides isolated peptides having the amino acid sequence of seq id no: 43 or immunologically active fragments thereof, which bind to hla antigen and have cytotoxic t lymphocyte (ctl) inducibility. The present invention further provides peptides which include one, two, or several amino acid insertions, substitution or addition to the aforementioned peptides or fragments, but still have the cytotoxic t cell inducibility.
07/17/14
20140199320
Modulators of the nlrp3 inflammasome il-1beta pathway for the prevention and treatment of acne
The invention provides inhibitors capable of binding to a member of the inflammasome group comprised of il-1β, il-1 receptor type 1, nlrp3, asc, caspase-1 and cathepsin b with a dissociation constant of 10-8 mol/l or smaller for the prevention and treatment of acne, specifically an antibody, an antibody fragment, an antibody-like molecule, an oligopeptide of 6 to 30 amino acid residues, a nucleic acid aptamer molecule of 10 to 75 nucleotides in length or a soluble polypeptide comprising a contiguous amino acid sequence of at least 30 amino acids comprised within the protein sequence of a member of the group comprised of il-1β, il-1 receptor type 1, il-1 receptor type 2, nlrp3, asc and caspase-1. Similarly, an interfering rna or an antisense modulator of gene expression of il-1β, i l-1β receptor type 1, nlrp3, asc, caspase-1 and cathepsin b are provided for the prevention or treatment of acne..
07/17/14
20140199315
Sp35 antibodies and uses thereof
Endogenous sp35 is a negative regulator for neuronal survival, axon regeneration, oligodendrocyte differentiation and myelination (negative regulator). Molecules that block endogenous sp35 function, such anti-sp35 antibodies can be used as therapeutics for the treatment of neuron and oligodendrocyte dysfunction.
07/17/14
20140199313
Process for the production of fine chemicals
The present invention relates to a process for the production of the fine chemical in a microorganism, a plant cell, a plant, a plant tissue or in one or more parts thereof, preferably in plastids. The invention furthermore relates to nucleic acid molecules, polypeptides, nucleic acid constructs, vectors, antibodies, host cells, plant tissue, propagation material, harvested material, plants, microorganisms as well as agricultural compositions and to their use..
07/17/14
20140199290
Genetic polymorphisms associated with alzheimer's disease, methods of detection and uses thereof
The present invention is based on the discovery of genetic polymorphisms that are associated with alzheimer's disease. In particular, the present invention relates to nucleic acid molecules containing the polymorphisms, variant proteins encoded by such nucleic acid molecules, reagents for detecting the polymorphic nucleic acid molecules and proteins, and methods of using the nucleic acid and proteins as well as methods of using reagents for their detection..
07/17/14
20140199272
Aav mediated exendin-4 gene transfer to salivary glands to protect subjects from diabetes or obesity
The invention relates to a gene transfer-based method to protect a subject from diabetes or obesity. The method comprises administering to a salivary gland of the subject an aav virion comprising an aav vector that encodes an exendin-4 protein.
07/17/14
20140199241
Liposomes comprising polymer-conjugated lipids and related uses
The present invention provides liposomes comprising a lipid bilayer and a polymer-conjugated lipid, wherein said polymer-conjugated lipid is incorporated into said lipid bilayer. The present invention also provides methods of producing the liposomes as well as a method of delivering a nucleic acid to a subject comprising the step of administering said nucleic acid encapsulated in a mixed liposome, a method for performing diagnostic imaging in a subject, comprising the step of administering a diagnostic agent encapsulated in a mixed liposome, and methods for treating, inhibiting, or suppressing a pathological condition in a subject comprising administering to said subject a mixed liposome..
07/17/14
20140199016
Illumination of optical analytical devices
Optical analytical devices and their methods of use are provided. The devices are useful in the analysis of highly multiplexed optical reactions in large numbers at high densities, including biochemical reactions, such as nucleic acid sequencing reactions.


Popular terms: [SEARCH]



Follow us on Twitter
twitter icon@FreshPatents

###

This listing is a sample listing of patent applications related to Nucleic Acid for is only meant as a recent sample of applications filed, not a comprehensive history. There may be associated servicemarks and trademarks related to these patents. Please check with patent attorney if you need further assistance or plan to use for business purposes. This patent data is also published to the public by the USPTO and available for free on their website. Note that there may be alternative spellings for Nucleic Acid with additional patents listed. Browse our RSS directory or Search for other possible listings.
     SHARE
  
         


FreshNews promo



0.2829

4910

2 - 1 - 101