FreshPatents.com Logo
Enter keywords:  

Track companies' patents here: Public Companies RSS Feeds | RSS Feed Home Page
Popular terms

[SEARCH]

Follow us on Twitter
twitter icon@FreshPatents

Web & Computing
Cloud Computing
Ecommerce
Search patents
Smartphone patents
Social Media patents
Video patents
Website patents
Web Server
Android patents
Copyright patents
Database patents
Programming patents
Wearable Computing
Webcam patents

Web Companies
Apple patents
Google patents
Adobe patents
Ebay patents
Oracle patents
Yahoo patents

[SEARCH]

Nuclei patents



      
           
This page is updated frequently with new Nuclei-related patent applications. Subscribe to the Nuclei RSS feed to automatically get the update: related Nuclei RSS feeds. RSS updates for this page: Nuclei RSS RSS


Date/App# patent app List of recent Nuclei-related patents
07/17/14
20140201871
 Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same patent thumbnailPolypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same
The present invention relates to isolated polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides..
07/17/14
20140201862
 Compositions and methods for altering alpha- and beta-tocotrienol content patent thumbnailCompositions and methods for altering alpha- and beta-tocotrienol content
Preparation and use of isolated nucleic acids useful in altering the oil phenotype in plants. Isolated nucleic acids and their encoded polypeptides that alter alpha- and beta-tocotrienol content in seeds and oil obtained from the seeds.
07/17/14
20140201858
 Methods for site-specific genetic modification in stem cells using xanthomonas tal nucleases (xtn) for the creation of model organisms patent thumbnailMethods for site-specific genetic modification in stem cells using xanthomonas tal nucleases (xtn) for the creation of model organisms
The invention relates to organisms and compositions comprising one or more stem cells or one or more embryos, wherein the one or more stem cells or one or more embryos comprise one or more of the following mutations: (i) a deletion mutation; (ii) a knockout mutation; and/or (iii) an addition of a heterologous nucleic acid sequence; wherein the one or more mutations of (i), (ii), and/or (iii) are site-specific mutations caused by a xanthomonas tal nuclease (xtn). The invention also relates to method of mutating an embryo, ips cell, stem cell, or more particularly a spermatogonial stem cell by exposing the nucleic acid sequence contained within such embryos or cell with a xanthomonas tal nuclease..
07/17/14
20140201855
 Mutant luciferases patent thumbnailMutant luciferases
Described are mutant luciferases, nucleic acids that encode them, cells and animals expressing them, methods of use thereof, and kits.. .
07/17/14
20140200187
 Cell-permeable peptide inhibitors of the jnk signal transduction pathway patent thumbnailCell-permeable peptide inhibitors of the jnk signal transduction pathway
The present invention refers to protein kinase inhibitors and more specifically to inhibitors of the protein kinase c-jun amino terminal kinase. Additionally, the present invention provides jnk inhibitor sequences, chimeric peptides, nucleic acids encoding same as well as pharmaceutical compositions for treating pathophysiologies associated with jnk signaling..
07/17/14
20140200163
 Multiplexed genetic reporter assays and compositions patent thumbnailMultiplexed genetic reporter assays and compositions
The invention provides methods for determining the activity of a plurality of nucleic acid regulatory elements. These methods may facilitate, e.g., the systematic reverse engineering, and optimization of mammalian cis-regulatory elements at high resolution and at a large scale.
07/17/14
20140200162
 Method and apparatus for nucleic acid analysis patent thumbnailMethod and apparatus for nucleic acid analysis
A convenient method for nucleic acid analysis is provided, which enables 1000 or more types of nucleic acid to be analyzed collectively with high comprehensiveness and with a dynamic range of at least four digits. In particular, provided is a very effective analytical method especially for untranslated rnas and micrornas, of which the types of target nucleic acids is 10000 or lower.
07/17/14
20140200147
 Methods and systems for genetic analysis patent thumbnailMethods and systems for genetic analysis
This disclosure provides systems and methods for sample processing and data analysis. Sample processing may include nucleic acid sample processing and subsequent sequencing.
07/17/14
20140199767
 Use patent thumbnailUse
The present invention relates to the use of one or more cas genes for modulating resistance in a cell against a target nucleic acid or a transcription product thereof.. .
07/17/14
20140199761
 Promoter-regulated differentiation-dependent self-deleting cassette patent thumbnailPromoter-regulated differentiation-dependent self-deleting cassette
Targeting constructs and methods of using them are provided for differentiation-dependent modification of nucleic acid sequences in cells and in non-human animals. Targeting constructs comprising a promoter operably linked to a recombinase are provided, wherein the promoter drives transcription of the recombinase in an differentiated cell but not an undifferentiated cell.
07/17/14
20140199760
Plants having enhanced abiotic stress resistance
Means are provided of increasing the growth potential and abiotic stress resistance in plants, characterized by expression of polynucleotides stably integrated into a plant genome or stably incorporated in the plant. Further provided are isolated nucleic acids and their stable inclusion in transgenic plants.
07/17/14
20140199754
Production of itaconic acid
The invention relates to a nucleic acid sequence encoding an itaconate transporting major facilitator superfamily transporter (mfst) gene sequence and the protein encoded thereby. Preferably said sequence is the nucleic acid that comprises the sequence of ateg_09972.1 of aspergillus terreus or homologues thereof.
07/17/14
20140199705
Glucanases, nucleic acids encoding them and methods for making and using them
The invention relates to polypeptides having glucanase, e.g., endoglucanase, mannanase, xylanase activity or a combination of these activities, and polynucleotides encoding them. In one aspect, the glucanase activity is an endoglucanase activity (e.g., endo-1,4-beta-d-glucan 4-glucano hydrolase activity) and comprises hydrolysis of 1,4-beta-d-glycosidic linkages in cellulose, cellulose derivatives (e.g., carboxy methyl cellulose and hydroxy ethyl cellulose) lichenin, beta-1,4 bonds in mixed beta-1,3 glucans, such as cereal beta-d-glucans or xyloglucans and other plant material containing cellulosic parts.
07/17/14
20140199699
Compositions and methods for rt-pcr
The present invention relates to methods and compositions having trehalose and dna polymerase for facilitating the rapid and efficient amplification of nucleic acid molecules and the detection and quantitation of rna molecules, and for increasing the detection sensitivity and reliability through generation of secure cdna molecules prior to gene-specific primer dependent amplification. The reagent mixture comprises a ready to use reagent solution, wherein the solution comprises: (a) trehalose in a concentration between about 5% and about 35%; (b) a viral reverse transcriptase; and (c) at least one dna polymerases, in a buffer suitable for use in a reverse transcription reaction, wherein the buffer comprises a co-factor metal ion and nucleoside triphosphates..
07/17/14
20140199693
Method of analysing a blood sample of a subject for the presence of a disease marker
The present invention relates to a method of analysing a blood sample of a subject for the presence of a disease marker, said method comprising the steps of a) extracting nucleic acid from anucleated blood cells in said blood sample to provide an anucleated blood cells-extracted nucleic acid fraction, and b) analysing said anucleated blood cells-extracted nucleic acid fraction for the presence of a disease marker, wherein said disease marker is a disease-specific mutation in a gene of a cell of said subject, or wherein said disease marker is a disease-specific expression profile of genes of a cell of said subject.. .
07/17/14
20140199689
Method for isolating nucleic acids
The present invention pertains to a method for isolating nucleic acids from a sample, preferably a blood sample, comprising the following steps: a) obtaining a sample which has been stabilised by the use of at least one cationic detergent, wherein the cationic detergent has formed complexes with the nucleic acids; b) obtaining the complexes optionally together with other sample components from the stabilised sample, wherein said complexes comprise the nucleic acids to be isolated; c) resuspending the complexes and optionally adding one or more additives before, during and/or after resuspension, thereby obtaining a resuspended sample comprising at least: i) the nucleic acid to be isolated; ii) at least one chaotropic agent; and iii) at least one chelating agent; and d) isolating nucleic acids from the resuspended sample. It was found that adding a chelating agent during resuspension considerably increases the nucleic acid yield as the formation of precipitates which irreversibly adhere to the container wall is considerably reduced..
07/17/14
20140199687
Nucleic acid sequences that can be used as primers and probes in the amplification and detection of all subtypes of hiv-1
The present invention is related to nucleic acid sequences that can be used in the field of virus diagnostics, more specifically the diagnosis of infections with the aids causing human immuno-deficiency virus (hiv). With the present invention nucleotide sequences are provided that can be used as primers and probes in the amplification and detection of hiv-1 nucleic acid.
07/17/14
20140199686
Compositions and methods for recovery of nucleic acids or proteins from tissue samples fixed in cytology media
The present invention provides compositions and methods for improving nucleic acid or protein recovery from fixed biological samples.. .
07/17/14
20140199684
Methods for amplifying hepatitis c virus nucleic acids
A method of amplifying an hcv nucleic acid in an hcv infected sample comprises amplifying a segment of a dna template that is complementary to a genome of hcv rna from the sample by a two-stage pcr, wherein a first stage pcr employs a first outer primer and a second outer primer, and a second stage pcr employs a first inner primer and a second inner primer. The nucleotide sequence of the first outer primer comprises a nucleotide sequence as set forth in seq id no: 2; or seq id no:9, wherein optionally 1, 2 or 3 nucleotides are other nucleotides than those of seq id no: 9.
07/17/14
20140199681
Blood collection device for stabilizing cell-free rna in blood during sample shipping and storage
A method for preserving and protecting cell-free nucleic acids located within blood plasma samples is disclosed, wherein a sample of blood containing nucleic acids is treated to reduce deleterious effects of storage and transport.. .
07/17/14
20140199402
Novel compounds for the treatment of inflammatory bowel disease
The present invention relates to a nucleic acid molecule of up to 150 nucleotides comprising consecutively from 5′ to 3′ (a) a first part whose sequence is between 50% and 100% complementary to the sequence aaaagcuggguugagagggcga; (b) a second part capable of forming a loop between the first and the third part; and (c) a third part comprising or consisting of the sequence aaaagcuggguugagagggcga; for use as a medicament. The present invention further relates to a nucleic acid molecule of up to 25 nucleotides comprising the sequence aaaagcuggguugagagggcga, for use as a medicament.
07/17/14
20140199370
Cyclodextrin-based materials compositions and uses related thereto
This application discloses cyclodextrin-modified materials for carrying drugs and other active agents, such as nucleic acids. Compositions are also disclosed of cyclodextrin-modified materials that release such active agents under controlled conditions.
07/17/14
20140199336
Tmem22 peptides and vaccines including the same
Isolated peptides composed of the amino acid sequence of seq id no: 33 or fragments thereof that bind to hla antigens and have cytotoxic t lymphocyte (ctl) inducibility and thus are suitable for use in the context of cancer immunotherapy, more particularly cancer vaccines are described herein. The present invention further provides peptides that include one, two, or several amino acid insertions, substitutions or additions to the aforementioned peptides or fragments, but yet retain the requisite cytotoxic t cell inducibility.
07/17/14
20140199335
C1orf59 peptides and vaccines including the same
The present invention provides isolated peptides having the amino acid sequence of seq id no: 43 or immunologically active fragments thereof, which bind to hla antigen and have cytotoxic t lymphocyte (ctl) inducibility. The present invention further provides peptides which include one, two, or several amino acid insertions, substitution or addition to the aforementioned peptides or fragments, but still have the cytotoxic t cell inducibility.
07/17/14
20140199320
Modulators of the nlrp3 inflammasome il-1beta pathway for the prevention and treatment of acne
The invention provides inhibitors capable of binding to a member of the inflammasome group comprised of il-1β, il-1 receptor type 1, nlrp3, asc, caspase-1 and cathepsin b with a dissociation constant of 10-8 mol/l or smaller for the prevention and treatment of acne, specifically an antibody, an antibody fragment, an antibody-like molecule, an oligopeptide of 6 to 30 amino acid residues, a nucleic acid aptamer molecule of 10 to 75 nucleotides in length or a soluble polypeptide comprising a contiguous amino acid sequence of at least 30 amino acids comprised within the protein sequence of a member of the group comprised of il-1β, il-1 receptor type 1, il-1 receptor type 2, nlrp3, asc and caspase-1. Similarly, an interfering rna or an antisense modulator of gene expression of il-1β, i l-1β receptor type 1, nlrp3, asc, caspase-1 and cathepsin b are provided for the prevention or treatment of acne..
07/17/14
20140199315
Sp35 antibodies and uses thereof
Endogenous sp35 is a negative regulator for neuronal survival, axon regeneration, oligodendrocyte differentiation and myelination (negative regulator). Molecules that block endogenous sp35 function, such anti-sp35 antibodies can be used as therapeutics for the treatment of neuron and oligodendrocyte dysfunction.
07/17/14
20140199313
Process for the production of fine chemicals
The present invention relates to a process for the production of the fine chemical in a microorganism, a plant cell, a plant, a plant tissue or in one or more parts thereof, preferably in plastids. The invention furthermore relates to nucleic acid molecules, polypeptides, nucleic acid constructs, vectors, antibodies, host cells, plant tissue, propagation material, harvested material, plants, microorganisms as well as agricultural compositions and to their use..
07/17/14
20140199290
Genetic polymorphisms associated with alzheimer's disease, methods of detection and uses thereof
The present invention is based on the discovery of genetic polymorphisms that are associated with alzheimer's disease. In particular, the present invention relates to nucleic acid molecules containing the polymorphisms, variant proteins encoded by such nucleic acid molecules, reagents for detecting the polymorphic nucleic acid molecules and proteins, and methods of using the nucleic acid and proteins as well as methods of using reagents for their detection..
07/17/14
20140199284
Structural mutations in titin cause dilated cardiomyopathy
Provided herein are diagnostic markers and methods for identifying a subject having an increased susceptibility for developing or having dilated cardiomyopathy. The method comprises determining if the subject has a mutation in the ttn nucleic as acid or titin polypeptide.
07/17/14
20140199272
Aav mediated exendin-4 gene transfer to salivary glands to protect subjects from diabetes or obesity
The invention relates to a gene transfer-based method to protect a subject from diabetes or obesity. The method comprises administering to a salivary gland of the subject an aav virion comprising an aav vector that encodes an exendin-4 protein.
07/17/14
20140199241
Liposomes comprising polymer-conjugated lipids and related uses
The present invention provides liposomes comprising a lipid bilayer and a polymer-conjugated lipid, wherein said polymer-conjugated lipid is incorporated into said lipid bilayer. The present invention also provides methods of producing the liposomes as well as a method of delivering a nucleic acid to a subject comprising the step of administering said nucleic acid encapsulated in a mixed liposome, a method for performing diagnostic imaging in a subject, comprising the step of administering a diagnostic agent encapsulated in a mixed liposome, and methods for treating, inhibiting, or suppressing a pathological condition in a subject comprising administering to said subject a mixed liposome..
07/17/14
20140199016
Illumination of optical analytical devices
Optical analytical devices and their methods of use are provided. The devices are useful in the analysis of highly multiplexed optical reactions in large numbers at high densities, including biochemical reactions, such as nucleic acid sequencing reactions.


Popular terms: [SEARCH]



Follow us on Twitter
twitter icon@FreshPatents

###

This listing is a sample listing of patent applications related to Nuclei for is only meant as a recent sample of applications filed, not a comprehensive history. There may be associated servicemarks and trademarks related to these patents. Please check with patent attorney if you need further assistance or plan to use for business purposes. This patent data is also published to the public by the USPTO and available for free on their website. Note that there may be alternative spellings for Nuclei with additional patents listed. Browse our RSS directory or Search for other possible listings.
     SHARE
  
         


FreshNews promo



0.2539

3574

1 - 1 - 78