FreshPatents.com Logo
Enter keywords:  

Track companies' patents here: Public Companies RSS Feeds | RSS Feed Home Page
Popular terms

[SEARCH]

Follow us on Twitter
twitter icon@FreshPatents

Web & Computing
Cloud Computing
Ecommerce
Search patents
Smartphone patents
Social Media patents
Video patents
Website patents
Web Server
Android patents
Copyright patents
Database patents
Programming patents
Wearable Computing
Webcam patents

Web Companies
Apple patents
Google patents
Adobe patents
Ebay patents
Oracle patents
Yahoo patents

[SEARCH]

Cursor patents



      
           
This page is updated frequently with new Cursor-related patent applications. Subscribe to the Cursor RSS feed to automatically get the update: related Cursor RSS feeds. RSS updates for this page: Cursor RSS RSS


Date/App# patent app List of recent Cursor-related patents
07/17/14
20140200659
 Capping bioprosthetic tissue to reduce calcification patent thumbnailCapping bioprosthetic tissue to reduce calcification
A treatment for bioprosthetic tissue used in implants or for assembled bioprosthetic heart valves to reduce in vivo calcification. The method includes applying a calcification mitigant such as a capping agent or an antioxidant to the tissue to specifically inhibit oxidation in tissue.
07/17/14
20140200349
 Manganese containing hydrosilylation catalysts and compositions containing the catalysts patent thumbnailManganese containing hydrosilylation catalysts and compositions containing the catalysts
A composition contains (a) a hydrosilylation reaction catalyst and (b) an aliphatically unsaturated compound having an average, per molecule, of one or more aliphatically unsaturated organic groups capable of undergoing hydrosilylation reaction. The composition is capable of reacting via hydrosilylation reaction to form a reaction product, such as a silane, a gum, a gel, a rubber, or a resin.
07/17/14
20140200348
 Vanadium containing hydrosilylation catalysts and compositions containing the catalysts patent thumbnailVanadium containing hydrosilylation catalysts and compositions containing the catalysts
A composition contains (a) a hydrosilylation reaction catalyst and (b) an aliphatically unsaturated compound having an average, per molecule, of one or more aliphatically unsaturated organic groups capable of undergoing hydrosilylation reaction. The composition capable of reacting via hydrosilylation reaction to form a reaction product, such as a silane, a gum, a gel, a rubber, or a resin.
07/17/14
20140200347
 Rhenium containing hydrosilylation catalysts and compositions containing the catalysts patent thumbnailRhenium containing hydrosilylation catalysts and compositions containing the catalysts
A composition contains (a) a hydrosilylation reaction catalyst and (b) an aliphatically unsaturated compound having an average, per molecule, of one or more aliphatically unsaturated organic groups capable of undergoing hydrosilylation reaction. The composition capable of reacting via hydrosilylation reaction to form a reaction product, such as a silane, a gum, a gel, a rubber, or a resin.
07/17/14
20140200345
 Production method for 2-alkenylamine compound patent thumbnailProduction method for 2-alkenylamine compound
Provided is a method for producing a 2-alkenylamine compound efficiently and at low cost, using a primary or secondary amine compound and a 2-alkenyl compound as the starting materials therefor. The 2-alkenyleamine compound is produced by 2-alkenylating a primary or secondary amine compound, using a specified 2-alkenylating agent and in the presence of a catalyst comprising a complexing agent and a transition metal precursor stabilized by a monovalent anionic five-membered conjugated diene..
07/17/14
20140200313
 Method for preparing dialkyl magnesium compounds by ethylene polymerisation and uses thereof patent thumbnailMethod for preparing dialkyl magnesium compounds by ethylene polymerisation and uses thereof
A process for the preparation by ethylene polymerization of at least one dialkyl magnesium compound of formula r—(ch2—ch2)n—mg—(ch2—ch2)m—r′ in which r and r′, identical or different, represent aryl, benzyl, allyl or alkyl groups and in which the integers n and m, identical or different, represent average —ch2—ch2— chain formation numbers greater than 1, the process including a single stage of mixing the following components: at least one ligand or one ligand precursor, at least one rare earth salt, at least one dialkyl magnesium compound of formula r—mg—r′, and ethylene, in a medium allowing contact between the components of the above mixture.. .
07/17/14
20140200300
 Precursor polyelectrolyte complexes compositions patent thumbnailPrecursor polyelectrolyte complexes compositions
The invention relates to compositions and methods of treatment employing compositions comprising polyelectrolyte complexes. The compositions include a water-soluble first polyelectrolyte bearing a net cationic charge or capable of developing a net cationic charge and a water-soluble second polyelectrolyte bearing a net anionic charge or capable of developing a net anionic charge.
07/17/14
20140200201
 Enzymatic production or chemical synthesis and uses for 5,7-dienes and uvb conversion products thereof patent thumbnailEnzymatic production or chemical synthesis and uses for 5,7-dienes and uvb conversion products thereof
Provided herein are steroidal compounds that are androsta-5,7-dienes or a pregna-5,7-dienes and ultraviolet b (uvb) conversion products thereof which includes pharmaceutical compositions of the steroidal compounds as shown in tables 1 and 2. Also provided is a method for producing hydroxylated metabolites of cholecalciferol or ergocalciferol via the p450scc (cyp11a1) or cyp27b1 enzyme systems where the hydroxylase has an activity to hydroxylate position c20 of a secosteroid or its 5,7-dieneal precursor and the hydroxylated metabolites so produced.
07/17/14
20140199915
 Novel enhanced filamentous silicone products and processes patent thumbnailNovel enhanced filamentous silicone products and processes
Filamentous bodies which are longitudinally extended and other film-like constructions are made by combining liquid siliceous precursors with air and extruding them. Distinct types or grades of fibers, strands, and other film-like constructions are produced which have a multiplicity of useful applications and indications for use owing to their inherent memory, compactability, tensile strength and density.
07/17/14
20140199850
 Dry-etch for selective oxidation removal patent thumbnailDry-etch for selective oxidation removal
Methods of selectively etching tungsten oxide relative to tungsten, silicon oxide, silicon nitride and/or titanium nitride are described. The methods include a remote plasma etch formed from a fluorine-containing precursor and/or hydrogen (h2).
07/17/14
20140199800
Luminescent materials that emit light in the visible range or the near infrared range and methods of forming thereof
Luminescent materials and methods of forming such materials are described herein. A method of forming a luminescent material includes: (1) providing a source of a and x, wherein a is selected from at least one of elements of group 1, and x is selected from at least one of elements of group 17; (2) providing a source of b, wherein b is selected from at least one of elements of group 14; (3) subjecting the source of a and x and the source of b to vacuum deposition to form a precursor layer over a substrate; (4) forming an encapsulation layer over the precursor layer to form an assembly of layers; and (5) heating the assembly of layers to a temperature theat to form a luminescent material within the precursor layer..
07/17/14
20140199478
Method for producing carbon membrane
Provided is a method of producing a carbon membrane including dipping a porous support in a suspension of a phenolic resin or a suspension of a phenolic resin precursor, drying the resulting support to form a membrane made of the phenolic resin or the phenolic resin precursor, and heat treating and thereby carbonizing the resulting membrane into a carbon membrane.. .
07/17/14
20140199402
Novel compounds for the treatment of inflammatory bowel disease
The present invention relates to a nucleic acid molecule of up to 150 nucleotides comprising consecutively from 5′ to 3′ (a) a first part whose sequence is between 50% and 100% complementary to the sequence aaaagcuggguugagagggcga; (b) a second part capable of forming a loop between the first and the third part; and (c) a third part comprising or consisting of the sequence aaaagcuggguugagagggcga; for use as a medicament. The present invention further relates to a nucleic acid molecule of up to 25 nucleotides comprising the sequence aaaagcuggguugagagggcga, for use as a medicament.
07/17/14
20140199278
Brown adipocyte modification
Methods and therapeutics are provided for treating metabolic disorders by increasing activation of brown adipose tissue. Generally, the methods and therapeutics can increase activation of brown adipose tissue to increase energy expenditure and induce weight loss.
07/17/14
20140198050
Multifunction touch keyboard module
A multifunction touch keyboard module includes a touch panel. The touch panel includes an ordinary area and a function area.
07/17/14
20140198040
Apparatus, system and method for self-calibration of indirect pointing devices
An apparatus, system, and method are disclosed for pointing device calibration. An observation module may track physical movement sensed by an indirect pointing device and record actual cursor behavior corresponding to the physical movement.
07/17/14
20140197583
Ceramic composition and ceramic injection-molding process
A ceramic composition for an injection-molding process for producing a combustion chamber pressure sensor, in particular for producing an insulation punch of a combustion chamber pressure sensor, includes a ceramic component in a proportion of greater than or equal to 50% by weight and a glass component in a proportion of less than or equal to 50% by weight. The ceramic component includes aluminum oxide.
07/17/14
20140197351
Lithium-ion-conducting materials
Lithium-ion-conducting ceramic materials are disclosed having characteristics of high lithium-ion conductivity at low temperatures, good current efficiency, and stability in water and corrosive media under static and electrochemical conditions. Some general formulas for the lithium-ion-conducting materials include mi1+x+z-δmiiixmivaymivb2-x-ymvzp3-zo12 and mi1+x+4z-δmiiixmivaymivb2-x-y-zp3o12, wherein mi comprises li, na, or mixtures thereof; 0.05<x<0.5, 0.05<y<2, 0≦z<3, and 0≦δ<0.5; miii comprises al, hf, sc, y, la, or mixtures thereof; miva comprises zr, ge, sn, or mixtures thereof; mivb comprises ti; and mv comprises si, ge, sn, or mixtures thereof.
07/17/14
20140196222
Conditioning dyeing agent for keratinous fibers
The specification describes an agent for coloring keratinic fibers. The agent includes, in a cosmetically acceptable carrier, at least one oxidation dye precursor, a precursor of a nature-analogous dye, a substantive dye, or combinations thereof.
07/10/14
20140195989
Input device, display device and method of controlling thereof
Exemplary embodiments may disclose an input device, a display device, and methods of controlling thereof. More particularly, exemplary embodiments may disclose an input device, a display device, and methods of controlling thereof, which inputs a command using gestures.
07/10/14
20140195986
Contactless remote control system and method for medical devices
The present invention provides a contactless remote control system enabling an operator to operate one or more medical devices in a contactless way, said remote control system comprising a display device for displaying a graphic user interface gui regarding the one or more medical devices; a tracking device for tracking the motion information of the operator; a control device for (1) interpreting the motion information of the operator into operation information relating to the movement trajectory of a cursor in the gui or the confirmation of the selection of an item in the gui where the cursor locates, and for (2) operating the gui in accordance with the operation information so as to generate control commands for the one or more medical devices; and an output device for outputting the control commands to the one or more medical devices. This system of the present invention enables the operator to operate and control the medical device in a more convenient way, and causes the degree of user satisfaction to be improved..
07/10/14
20140195985
Display apparatus, ui display method thereof and computer-readable recording medium
A display apparatus which corrects input characters by moving a cursor in word units is provided. The display apparatus includes a communication interface configured to receive a control command for a character input from a control device, a display configured to display characters corresponding to the control command, and a controller configured to control the display to move a cursor in word units when a correction command to correct the displayed characters is received..
07/10/14
20140195978
Granular graphical user interface element
A graphical user interface (gui) element permits a user to control an application in both a coarse manner and a fine manner. When a cursor is moved to coincide or overlap the displayed gui element, parameter adjustment is made at a first (coarse) granularity so that rapid changes to the target parameter can be made (e.g., displayed zoom level, image rotation or playback volume).
07/10/14
20140194887
Device, composition and method for prevention of bone fracture and pain
Methods, apparatus, compositions for reinforcing bone structures are disclosed as well as a reinforced bone structure itself. By injecting a low viscosity polymeric solution into a trabecular bone region at least partly surrounded by cortical bone allowing it to cross-link in-situ, a non-degradable gel can effectively reinforce the region by retaining fluid in the constrained space within the cortical shell.
07/10/14
20140194638
Spirobenzylamine-phosphine, preparation method therefor and use thereof
The present invention relates to a spirobenzylamine-phosphine, preparation method therefor and use thereof. The compound has a structure represented by formula (i), wherein n=0 to 3; r1, r2, r3, r4, r5, r6, r7, r8 and r9 having a value as defined in claim 1.
07/10/14
20140194627
Zinc containing hydrosilylation catalysts and compositions containing the catalysts
A composition contains (a) a hydrosilylation reaction catalyst and (b) an aliphatically unsaturated compound having an average, per molecule, of one or more aliphatically unsaturated organic groups capable of undergoing hydrosilylation reaction. The composition capable of reacting via hydrosilylation reaction to form a reaction product, such as a silane, a gum, a gel, a rubber, or a resin.
07/10/14
20140194620
18f-labeled precursor of pet radioactive medical supplies, and preparation method thereof
The present invention relates to a precursor of positron emission tomography (pet) radioactive medical supplies, a preparation method thereof, and an application thereof, and more specifically, to a precursor having a tetravalent organic salt leaving group, a preparation method, and a method for preparing desired pet radioactive medical supplies in a high radiochemical yield within a short preparation time by introducing 18f using the same through a single step. The precursor having a tetravalent organic salt leaving group of the present invention can simplify the known complex multistep preparation of radioactive medical supplies into a single step, can save production costs because an excessive amount of a phase transfer catalyst is not required, facilitates separation of a compound after reaction, and enables rapid reaction velocity.
07/10/14
20140194603
Method for the production of lignin-containing precursor fibres and also carbon fibres
The invention relates to a method for the production of a precursor for the production of carbon- and activated carbon fibres according to the wet- or air-gap spinning method, in which a solution of lignin and a fibre-forming polymer in a suitable solvent is extruded through the holes of a spinning nozzle into a coagulation bath, the formed thread is stretched and subsequently treated, dried at an elevated temperature and then wound up. The lignin-containing thread is an economical starting material for the production of carbon- and activated carbon fibres..
07/10/14
20140194572
Adhesive composition and easily dismantlable adhesive tape
The present invention provides an easily dismantlable adhesive composition as an adhesive composition containing an acrylic polymer (x) that contains a (meth)acrylate monomer as a main monomer component, and an acid catalyst or an acid generator, in which the acrylic polymer (x) contains a poly(meth)acrylate chain (a) that is formed of repeating units derived from a carboxyl precursor group-containing (meth)acrylate monomer (a), and a number of the repeating units is 10 or greater.. .
07/10/14
20140194546
Easily dismantlable adhesive composition and easily dismantlable adhesive tape
An easily dismantlable adhesive composition containing: an acrylic block polymer having a poly(meth)acrylate chain (a) formed of a carboxyl precursor group-containing (meth)acrylate monomer (a) and a poly(meth)acrylate chain (b) that contains, as monomer components, a (meth)acrylate (b) having an alkyl group having 1 to 14 carbon atoms and a polar group-containing monomer (c); and either an acid catalyst or an acid generator, makes it possible to achieve favorable adhesiveness and dismantlability and suppress stick-slip at the time of dismantlement.. .
07/10/14
20140194509
Hydroxybutyrate ester and medical use thereof
A compound which is 3-hydroxybutyl 3-hydroxybutyrate enantiomerically enriched with respect to (3r)-hydroxybutyl (3r)-hydroxybutyrate of formula (i) is an effective and palatable precursor to the ketone body (3r)-hydroxybutyrate and may therefore be used to treat a condition which is caused by, exacerbated by or associated with elevated plasma levels of free fatty acids in a human or animal subject, for instance a condition where weight loss or weight gain is implicated, or to promote alertness or improve cognitive function, or to treat, prevent or reduce the effects of neurodegeneration, free radical toxicity, hypoxic conditions or hyperglycaemia.. .
07/10/14
20140193983
Apparatuses and methods for depositing sic/sicn films via cross-metathesis reactions with organometallic co-reactants
Disclosed herein are methods of forming sic/sicn film layers on surfaces of semiconductor substrates. The methods may include introducing a silicon-containing film-precursor and an organometallic ligand transfer reagent into a processing chamber, adsorbing the silicon-containing film-precursor, the organometallic ligand transfer reagent, or both onto a surface of a semiconductor substrate under conditions whereby either or both form an adsorption-limited layer, and reacting the silicon-containing film-precursor with the organometallic ligand transfer reagent, after either or both have formed the adsorption-limited layer.
07/10/14
20140193910
Methods for producing pancreatic precursor cells and uses thereof
The present invention is directed to methods for readily propagating somatic pancreatic precursor cells. The methods comprise isolating cells from intact pancreatic samples and enhancing guanine nucleotide (gnp) biosynthesis in cultures comprising these cells, thereby expanding guanine nucleotide pools.
07/10/14
20140193752
Stabilized acid amplifiers
There are disclosed sulfonic acid precursor compositions, as are methods of using these compositions in, for example, photolithography. Other embodiments are also disclosed..
07/10/14
20140193647
Coatings for solar applications
The present invention discloses coating compositions comprising: i) at least one highly absorbing material selected from the group consisting of ruthenium, iridium and osmium compounds, and mixtures thereof; ii) an inorganic glass binder or a precursor thereof; iii) a ceramic filler comprising metal oxides, metal powders and mixtures thereof; and v) a liquid organic vehicle. The invention further discloses methods for preparing these coatings and uses thereof in solar applications..
07/10/14
20140193598
Multilayer adhesive film, in particular for bonding optical sensors
A multilayer pressure sensitive adhesive (psa) film having a first acrylic pressure sensitive adhesive layer and an opposing second acrylic pressure sensitive adhesive layer, wherein the first pressure sensitive adhesive layer has a glass transition temperature tg≧0° c. And a content of a strongly polar acrylate of 7.5 to 15 wt.-% in its precursor, and the second pressure sensitive adhesive layer has a tg≦0° c.
07/10/14
20140193585
Method for modifying probe tip
A method for modifying the probe tip of a microscope, including the following steps of providing a substrate, providing a metal precursor solution with fluoride ion on the substrate, using the probe tip to dip into the metal precursor solution with fluoride ion on the substrate in order to form a nano-metal particle on the probe tip by the reduction reaction of at least one metal ion in the metal precursor solution. As the result, the probe tip having the nano-metal particle thereon can increase the spatial-resolution of the measuring performance of the field sensitive scanning probe microscope due to the great reduction of stray field effects..
07/10/14
20140193579
Combination cvd/ald method and source
The present invention relates generally to methods and apparatus for the controlled growing of material on substrates. According to embodiments of the present invention, a precursor fed is split in to two paths from a precursor source.
07/10/14
20140193578
Splashguard and inlet diffuser for high vacuum, high flow bubbler vessel
The present invention is a bubbler having a diptube inlet ending in a bubble size reducing outlet and at least one baffle disc positioned between the outlet of the diptube and the outlet of the bubbler to provide a narrow annular space between the baffle disc and the wall of the bubbler to prevent liquid droplets from entering the outlet to the bubbler. The bubble size reducing outlet is an elongated cylindrical porous metal frit situated in a sump of approximately the same dimensions.
07/10/14
20140193522
Mixtures for producing chlorine dioxide gas in enclosures and methods of making the same
The present disclosure relates to a mixture for producing chlorine dioxide gas provided in an enclosure comprising an impregnate comprising a chlorine dioxide precursor impregnated in a porous carrier and a proton-generating species, wherein the impregnate and proton-generating species are intermixed to produce a stable mixture and the mixture is provided in an enclosure. The present disclosure also relates to methods for producing chlorine dioxide gas..
07/10/14
20140193499
Bioactive glass composition, its applications and respective preparation methods
The present invention relates to development of bioactive glass/glass-ceramic composition that are able to promote a fast deposition layer of carbonated hydroxyapatite upon immersion in simulated body fluid (sbf) for time periods as short as one hour. Such composition might include fluorides, and a variety of oxides (or their precursor compounds), such as na2o—ag2o—sro—cao—mgo—zno—p2o5—sio2—bi2o3—b2o3—caf2, be prepared by the melt route or by the sol-gel process, with the specific composition and the preparation route selected according to the intended functionalities, which can present controlled biodegradation rate and bactericidal activity.
07/10/14
20140193380
Technologies, methods, and products of small molecule directed tissue and organ regeneration from human pluripotent stem cells
Pluripotent human embryonic stem cells (hescs) hold great potential for restoring tissue and organ function, which has been hindered by inefficiency and instability of generating desired cell types through multi-lineage differentiation. This instant invention is based on the discovery that pluripotent hescs maintained under defined culture conditions can be uniformly converted into a specific lineage by small molecule induction.
07/10/14
20140193364
Tam receptor ligands, metabolites and precursors thereof in the detection and modulation of inflammatory neuropathological disease
The present disclosure relates to the use of tam receptor ligands, metabolites, precursor and binding partners thereof in the field of inflammatory neuropathology. This includes the early diagnosis and monitoring of an inflammatory neuropathology as well as screening for medicaments used in the treatment and prophylaxis of such a condition.
07/10/14
20140191958
Cursor control method for a touch screen
When a cursor control mode of an electronic device is enabled, an arrow cursor is converted into a transparent ball on a touch screen and touch input at any area of the touch screen is simulated as a contact point of a tangent plane to a virtual sphere utilized to be forced to roll on a virtual surface with specific rolling direction and speed, as the touch input moves along a specific direction with a specific speed on the touch screen. The data of the rolling direction and speed of the virtual sphere will be converted to corresponding movements of the transparent ball on the touch screen.
07/10/14
20140191423
Splashguard and inlet diffuser for high vacuum, high flow bubbler vessel
The present invention is a bubbler having a diptube inlet ending in a bubble size reducing outlet and at least one baffle disc positioned between the outlet of the diptube and the outlet of the bubbler to provide a narrow annular space between the baffle disc and the wall of the bubbler to prevent liquid droplets from entering the outlet to the bubbler. The bubble size reducing outlet is an elongated cylindrical porous metal frit situated in a sump of approximately the same dimensions.
07/10/14
20140191406
Manufacturing method for semiconductor package, semiconductor package, and semiconductor device
One aspect of the present invention resides in a manufacturing method for a semiconductor package, including a covering step of forming a covering insulating layer that covers the surface of a semiconductor element, a film-forming step of forming a resin film on the surface of the covering insulating layer, a circuit pattern-forming step of forming a circuit pattern portion including recesses reaching the surfaces of electrodes of the semiconductor element and a circuit groove having a desired shape and a desired depth, a catalyst-depositing step of depositing a plating catalyst or a precursor thereof on the surface of the circuit pattern portion, a film-separating step of separating the resin film from the covering insulating layer, and a plating processing step of forming a circuit electrically connected to the electrodes, by applying electroless plating to the covering insulating layer, from which the resin film is separated.. .
07/10/14
20140191222
Resin composition and display device using the same
The resin composition of the present invention is a resin composition characterized by including (a) a polyimide, a polybenzoxazole, a polyimide precursor or a polybenzoxazole precursor, (b) 1,5-dihydroxynaphthalene, 1,6-dihydroxynaphthalene, 1,7-dihydroxynaphthalene, or 2,3-dihydroxynaphthalene, and (c) a thermal cross-linking agent having a specific structure. By the use of the resin composition of the present invention, it is possible to reduce the transmittance in the visible region of a cured film while maintaining the transmittance of a resin film before curing..
07/10/14
20140191157
Composition for acid gas tolerant removal of mercury from a flue gas
Compositions and method useful for removal of mercury from a flue gas stream with relatively high concentrations of acid gas precursors and/or acid gases. The method includes contacting the flue gas stream with a sorbent composition comprising a sorbent material and a multi-functional agent, where the multi-functional agent includes a compound having a metal of valency 3 or higher.
07/10/14
20140190870
Synergistic h2s scavenger combination of transition metal salts with water-soluble aldehydes and aldehyde precursors
The use of a composition including a transition metal salt and at least one water-soluble aldehyde or water-soluble aldehyde precursor scavenges h2s that is present in aqueous fluids (e.g. Produced water liquid streams), natural gas and in oil and mixtures thereof (e.g.
07/10/14
20140190818
Method for stabilizing carbon-containing fibre and method for producing carbon fibre
The group of inventions pertains to the field of producing high-strength carbon fibres, which can be primarily manufactured from an organic starting material (precursor). A method for stabilizing a carbon-containing fibre (precursor) is claimed, in which the fibre is placed into a gaseous medium and subjected to treatment with microwave radiation as the gaseous medium is heated.
07/10/14
20140190565
Polymer/inorganic multi-layer encapsulation film
This invention relates to a polymer/inorganic multi-layer encapsulation film, and more particularly, to a multi-layer encapsulation film, which includes a plasma polymer thin film layer formed using a cross-shaped precursor having si—o bonding and an inorganic thin film layer, and ensures flexibility and has improved encapsulation.. .
07/10/14
20140190508
Method
A method of removing colour from hair that has been oxidatively dyed, the method comprising the steps of: (a) contacting the hair with a composition comprising a sulfur-containing nucleophile or a precursor thereof; (b) contacting the hair with an acidic composition; and (c) contacting the hair with an oxidising composition; wherein there is no rinsing step between step (a) and step (b).. .
07/10/14
20140190411
Lid assembly for a processing system to facilitate sequential deposition techniques
Embodiments of the invention generally relate to apparatuses for processing substrates. In one embodiment, a substrate processing system is provided and includes a lid having an upper lid surface opposed to a lower lid surface, a plurality of gas inlet passages extending from the upper lid surface to the lower lid surface, a gas manifold disposed on the lid, at least one valve coupled with the gas manifold and configured to control a gas flow through one of the gas inlet passages, wherein the at least one valve is configured to provide an open and close cycle having a time period of less than about 1 second during a gas delivery cycle for enabling an atomic layer deposition process.
07/03/14
20140188777
Methods and systems for identifying a precursor to a failure of a component in a physical system
A computer-implemented system for identifying a precursor to a failure of a particular type of component in a physical system is provided. The physical system includes sensors coupled to the physical system.
07/03/14
20140188032
Cerebrospinal fluid drainage
A cerebrospinal fluid drainage. The abstract of the disclosure is submitted herewith as required by 37 c.f.r.
07/03/14
20140187792
Condensed polycyclic aromatic compound, aromatic polymer, and method for synthesizing aromatic compound
Provided is a condensed polycyclic aromatic compound that can be used as a precursor for synthesizing a condensed polycyclic aromatic compound having relatively high solubility. Also provided is a method for synthesizing and using such a novel condensed polycyclic aromatic compound.
07/03/14
20140187783
Hafnium containing hydrosilylation catalysts and compositions containing the catalysts
A composition contains (a) a hydrosilylation reaction catalyst and (b) an aliphatically unsaturated compound having an average, per molecule, of one or more aliphatically unsaturated organic groups capable of undergoing hydrosilylation reaction. The composition is capable of reacting via hydrosilylation reaction to form a reaction product, such as a silane, a gum, a gel, a rubber, or a resin.
07/03/14
20140187769
Oxadiazoanthracene compounds for the treatment of diabetes
Wherein a, b, c, r, r1, r2, r3, r4 and r5 are as herein described, and methods of synthesizing precursors to these oxadiazoanthracene derivatives.. .
07/03/14
20140187663
Telechelic macromer, method for producing telechelic macromer and composition containing telechelic macromer
A telechelic macromer is disclosed having (meth)acrylic end-groups and a core. The macromer defined by formula 1 comprises a core y (formulas 2 to 9) that is linked to (meth)acrylic groups by urethane, ester or anhydride bonds and has iodine value ranging from 5 to 75.
07/03/14
20140187018
Methods for reproducible flash layer deposition
A method for reducing the leakage current in dram metal-insulator-metal capacitors includes forming a flash layer between the dielectric layer and the first electrode layer. A method for reducing the leakage current in dram metal-insulator-metal capacitors includes forming a capping layer between the dielectric layer and the second electrode layer.
07/03/14
20140186928
Recombinant microorganism and methods of production thereof
The invention relates, inter alia, to novel genetically modified microorganisms capable of using co to produce 1-butanol and/or a precursor thereof, novel methyltransferases and nucleic acids encoding same, methods for producing genetically modified microorganisms using said novel methyltransferases, and methods of producing 1-butanol and/or a precursor thereof by microbial fermentation.. .
07/03/14
20140186768
Photosensitive resin composition for insulating film of display device, insulating film using the same, and display device using the same
A photosensitive resin composition for an insulating film of a display device includes (a) an alkali soluble resin including a polybenzoxazole precursor, polyamic acid, polyimide, or a combination thereof; (b) a photosensitive diazoquinone compound; (c) an ultraviolet (uv) absorber having a maximum absorption wavelength of about 300 to about 400 nm; and (d) a solvent. An insulating film and a display device can include the photosensitive resin composition..
07/03/14
20140186748
Method for producing alloy catalyst for fuel cells using silica coating
Disclosed is a method for producing an alloy catalyst supported on carbon, including the steps of: dispersing alloy particles into a mixed solution of water with alcohol, introducing a silica precursor thereto, and carrying out sol-gel reaction in the presence of a basic catalyst to obtain silica-coated alloy particles; supporting the silica-coated alloy particles onto a carbon carrier to obtain silica-coated alloy particles supported on carbon; heat treating the silica-coated alloy particles supported on carbon to increase an alloying degree; and removing silica coating by using inorganic base solution and a surfactant. The method for producing an alloy catalyst provides a high-quality and high-durability alloy catalyst by increasing the alloying degree of a catalyst through a heat treatment step, while forming a silica coating layer effectively on small alloy particles having a size of several nanometers to inhibit growth of the size of alloy particles.
07/03/14
20140186640
Anti-adhesion transparent thin film and method for forming the same
The present invention provides an anti-adhesion transparent thin film, which uses physical vapor deposition to deposit a transparent thin film on the surface of a substrate. The transparent film has the characteristics of high light perviousness, good hardness, excellent acid resistivity, and superior anti-adhesion capability.
07/03/14
20140186625
Composition for acid gas tolerant removal of mercury from a flue gas
Method and compositions useful for removal of mercury from a flue gas stream with relatively high concentrations of acid gas precursors and/or acid gases. The method includes contacting the flue gas stream with a multi-functional agent, where the multi-functional agent includes a salt having a cation of valency 3 or higher.
07/03/14
20140186623
A method of preparing metal oxide microtubes
The present invention prescribes a new sol-gel method of preparing and formation of the metal oxide microtubes. According to the method firstly is prepared the precursor sol from metal oxides or mixtures of metal oxides and alkoxides, thereafter from the precursor sol are extruded the fibres, which are gelatinised afterwards until the inner sol which is less viscous of fibres is converted to thinner wall until alcohol from the precursor is left trough walls.
07/03/14
20140186560
Heat exchanger tube precursor and method of producing the same
A heat exchanger tube precursor that allows manufacturing a heat exchanger having high corrosion resistance after brazing treatment is provided. The heat exchanger tube precursor includes: an al alloy tube; and a flux layer including a si powder, a zn-containing flux, a zn-free flux, and a binder, the flux layer being formed on an outer surface of the al alloy tube..
07/03/14
20140186550
Methods for the production of aligned carbon nanotubes and nanostructured material containing the same
Disclosed herein is a scaled method for producing substantially aligned carbon nanotubes by depositing onto a continuously moving substrate, (1) a catalyst to initiate and maintain the growth of carbon nanotubes, and (2) a carbon-bearing precursor. Products made from the disclosed method, such as monolayers of substantially aligned carbon nanotubes, and methods of using them are also disclosed..
07/03/14
20140186420
Drug cores for sustained release of therapeutic agents
A solid drug core insert can be manufactured by injecting a liquid mixture comprising a therapeutic agent and a matrix precursor into a sheath body. The injection can be conducted at subambient temperatures.
07/03/14
20140186314
Pure populations of astrocyte restricted precursor cells and methods for isolation and use thereof
An isolated, pure homogeneous population of mammalian astrocyte restricted precursor cells which is cd44 immunoreactive and which generate astrocytes but not oligodendrocytes is provided. Methods for isolating and using these mammalian astrocyte restricted precursor cells are also provided..
07/03/14
20140186132
Twist drill tips, precursor constructions for use in making same, and methods for making and using same
A tip for twist drill, comprising a super-hard structure joined to a substrate at an interface boundary coterminous with an end of the substrate, the super-hard structure comprising sintered polycrystalline material comprising super-hard grains, the super-hard structure defining a super-hard end surface opposite the interface boundary and a plurality of cutting edges configured for boring into a body in use; the super-hard end surface including a centre point or chisel edge, and comprising a plurality of surface regions configured such that respective planes tangential to each of the surface regions are disposed at substantially different angles from the axis of rotation of the tip in use. Precursor constructions for use in manufacturing the tips as well as methods for making the precursor constructions and the tips are disclosed..


Popular terms: [SEARCH]



Follow us on Twitter
twitter icon@FreshPatents

###

This listing is a sample listing of patent applications related to Cursor for is only meant as a recent sample of applications filed, not a comprehensive history. There may be associated servicemarks and trademarks related to these patents. Please check with patent attorney if you need further assistance or plan to use for business purposes. This patent data is also published to the public by the USPTO and available for free on their website. Note that there may be alternative spellings for Cursor with additional patents listed. Browse our RSS directory or Search for other possible listings.
     SHARE
  
         


FreshNews promo



0.3931

2979

449494 - 0 - 71