FreshPatents.com Logo
Enter keywords:  

Track companies' patents here: Public Companies RSS Feeds | RSS Feed Home Page
Popular terms

[SEARCH]

Follow us on Twitter
twitter icon@FreshPatents

Web & Computing
Cloud Computing
Ecommerce
Search patents
Smartphone patents
Social Media patents
Video patents
Website patents
Web Server
Android patents
Copyright patents
Database patents
Programming patents
Wearable Computing
Webcam patents

Web Companies
Apple patents
Google patents
Adobe patents
Ebay patents
Oracle patents
Yahoo patents

[SEARCH]

Cursor patents



      
           
This page is updated frequently with new Cursor-related patent applications. Subscribe to the Cursor RSS feed to automatically get the update: related Cursor RSS feeds. RSS updates for this page: Cursor RSS RSS


Process for making lithographic printing plate

Compositions and methods for recognition of rna using triple helical peptide nucleic acids

Date/App# patent app List of recent Cursor-related patents
07/24/14
20140208273
 Cursor control patent thumbnailnew patent Cursor control
Certain embodiments provide a computer system for controlling the movement of a displayed cursor, the computer system comprising: a first display region; a second display region; a user input unit configured to measure movements made by a user in association with the user input unit and to output corresponding movement signaling; a vision tracking unit configured to determine a direction in which a user is looking and to output corresponding view-direction signaling; and a cursor control unit arranged to select one of the first display region and the second display region as a selected display region based on the view-direction signaling associated with the vision tracking unit and to control a cursor to move within the selected display region based on the movement signaling associated with the user input unit.. .
07/24/14
20140208246
 Supporting user interactions with rendered graphical objects patent thumbnailnew patent Supporting user interactions with rendered graphical objects
A graphical object is rendered to a pixel buffer, such that a software application executing on a computing device displays the contents of the pixel buffer via a user interface. An invisible element is created and positioned under the cursor in response to detecting that the cursor is positioned over the feature being displayed via the user interface.
07/24/14
20140207132
 Treatment system patent thumbnailnew patent Treatment system
A treatment system includes a treatment instrument that has a pair of freely openable/closable holding sections for applying thermal energy generated by a heat generation section to a living tissue lt held between the holding sections, a signal output section that supplies an alternating current drive signal to the heat generation section, a setting section that sets a target temperature of the heat generation section, a signal detection section that detects a current and a voltage of the drive signal, a control section that controls a temperature of the heat generation section by adjusting power of the drive signal, a signal extraction section that extracts a direct current component from the drive signal detected by the signal detection section and a fault detection section that detects a precursory phenomenon of a fault of the heat generation section based on the extracted signal extracted by the signal extraction section.. .
07/24/14
20140206901
 Recombinant microorganisms and methods of use thereof patent thumbnailnew patent Recombinant microorganisms and methods of use thereof
The invention relates to methods for the production of chemical compounds, particularly but not exclusively ethanol, by microbial fermentation. Also described are genetically modified micro-organisms capable of using carbon monoxide to produce one or more products, particularly but not exclusively ethanol as a main product, and producing a reduced amount or substantially no 2,3-butanediol and/or a precursor thereof..
07/24/14
20140206871
 Low abuk oxycodone, its salts and methods of making same patent thumbnailnew patent Low abuk oxycodone, its salts and methods of making same
A method of preparing oxycodone includes forming 14-hydroxycodeine by reduction of 14-hydroxycodeinone and rearrangement of the 14-hydroxycodeine to form the oxycodone. During the reduction step, the ketone group of an undesirable contaminant precursor, 8,14-dihydroxy-7,8-dihydrocodeinone, is reduced to a hydroxyl group thus forming a triol.
07/24/14
20140206869
 Iridium containing hydrosilylation catalysts and compositions containing the catalysts patent thumbnailnew patent Iridium containing hydrosilylation catalysts and compositions containing the catalysts
A composition contains (a) a hydrosilylation reaction catalyst and (b) an aliphatically unsaturated compound having an average, per molecule, of one or more aliphatically unsaturated organic groups capable, of undergoing hydrosilylation reaction. The composition is capable of reacting via hydrosilylation reaction to form a reaction product, such as a silane, a gum, a gel, a rubber, or a resin.
07/24/14
20140206863
 Copper containing hydrosilylation catalysts and compositions containing the catalysts patent thumbnailnew patent Copper containing hydrosilylation catalysts and compositions containing the catalysts
A composition contains (a) a hydrosilylation reaction catalyst and (b) an aliphatically unsaturated compound having an average, per molecule, of one or more aliphatically unsaturated organic groups capable of undergoing hydrosilylation reaction. The composition capable of reacting via hydrosilylation reaction to form a reaction product, such as a silane, a gum, a gel, a rubber, or a resin.
07/24/14
20140206838
 Compositions and methods for recognition of rna using triple helical peptide nucleic acids patent thumbnailnew patent Compositions and methods for recognition of rna using triple helical peptide nucleic acids
Peptide nucleic acids containing thymidine and 2-aminopyridine (m) nucleobases formed stable and sequence selective triple helices with double stranded rna at physiologically relevant conditions. The m-modified pna displayed unique rna selectivity by having two orders of magnitude higher affinity for the double stranded rnas than for the same dna sequences.
07/24/14
20140206837
 Targeting vector-phospholipid conjugates patent thumbnailnew patent Targeting vector-phospholipid conjugates
Peptide vectors having high kdr binding affinity and processes for making such vectors are provided. The peptide vectors may be conjugated to phospholipids and included in ultrasound contrast agent compositions.
07/24/14
20140206791
 Dispersions of nanoscale dental glass particles and methods for preparing the same patent thumbnailnew patent Dispersions of nanoscale dental glass particles and methods for preparing the same
Provided are a dispersion of a nanoparticulate mixed oxide of sio2 with at least one further metal oxide in a matrix monomer, methods for preparing such a dispersion, a dental composite producible by curing such a dispersion, and uses of the dispersion as a precursor for dental composites.. .
07/24/14
20140206687
new patent Quinazoline derivative, preparation method therefor, intermediate, composition and application thereof
Disclosed are as represented by formula (i) a quinazoline derivative and a pharmaceutical acceptable salt thereof, or, an enantiomer, a non-enantiomer, a tautomer, a racemate, a solvate, a metabolic precursor, or a prodrug of both. Also disclosed are a preparation method therefor, an intermediate, a pharmaceutical composition having the quinazoline derivative, and an application thereof.
07/24/14
20140206630
new patent Phenolic coatings and methods of making and using same
A method of making a facile, surface-independent, polyphenol coating is disclosed. In general, the method includes contacting at least a portion of the substrate to be coated with an aqueous solution containing one or more salts and one or more nitrogen-free phenolic compounds.
07/24/14
20140206529
new patent Apparatus and method for manufacturing silica-titania catalyst
Provided are an apparatus and method for preparing a silica-titania catalyst. The apparatus for preparing a silica-titania catalyst, comprising: precursor supplying units; an oxygen supplying line; a reaction unit; and a recovering unit, wherein the precursor supplying units vaporize a silica precursor and titania precursor and supply them to the reaction unit, wherein the oxygen supplying line supplies an oxygen source to the reaction unit, wherein the reaction unit converts vaporizates of the silica precursor and titania precursor supplied from the precursor supplying units to produce a silica-titania catalyst, wherein the recovering unit cools, condenses and collects the silica-titania catalyst produced at the reaction unit, wherein the recovering unit comprises a cooler for cooling the silica-titania catalyst introduced from the reaction unit, and the cooler comprises a turbulence-forming section on a flow path of the silica-titania catalyst..
07/24/14
20140206528
new patent Porous body precursors, shaped porous bodies, processes for making them, and end-use products based upon the same
The present invention provides porous body precursors and shaped porous bodies. Also included are catalysts and other end-use products based upon the shaped porous bodies and thus the porous body precursors.
07/24/14
20140206251
new patent Surface modifying agents, modified materials and methods
The present invention relates to surface modifying agents for polymeric and/or textile materials, methods of making and/or using a surface modifying agent to modify and functionalize polymeric and/or textile materials, and/or methods of using surface modified or functionalized polymeric and textile materials, and/or products using or incorporating surface modified or functionalized polymeric and textile materials. For example, the surface modifying agent in precursor form can be styrene sulfonyl azide monomer, polymer or copolymer capable of undergoing a chemical reaction in the presence of heat or light to form one or more styrene sulfonated nitrene monomers, polymers or copolymers, which are capable of chemically reacting with the surface of a polymeric or textile material to endow a specific or desired chemical surface functionality to the surface of a polymeric or textile material.
07/24/14
20140206195
new patent Process for removing carbon material from substrates
A method of removing carbon materials, preferably amorphous carbon, from a substrate includes dispensing a liquid sulfuric acid composition including sulfuric acid and/or its desiccating species and precursors and having a water/sulfuric acid molar ratio of no greater than 5:1 onto an material coated substrate in an amount effective to substantially uniformly coat the carbon material coated substrate. The liquid sulfuric acid composition is exposed to water vapor in an amount effective to increase the temperature of the liquid sulfuric acid composition above the temperature of the liquid sulfuric acid composition prior to exposure to the water vapor.
07/24/14
20140206190
new patent Silicide formation in high-aspect ratio structures
Embodiments of the present invention include methods of forming a silicide layer on a semiconductor substrate. In an exemplary embodiment, a metal layer may first be deposited above a semiconductor substrate using a chemical vapor deposition process with a metal amidinate precursor and then the semiconductor substrate may be annealed, causing the semiconductor substrate to react with the metal layer forming a metal-rich silicide layer on the semiconductor substrate.
07/24/14
20140206136
new patent Antimony compounds useful for deposition of antimony-containing materials
Precursors for use in depositing antimony-containing films on substrates such as wafers or other microelectronic device substrates, as well as associated processes of making and using such precursors, and source packages of such precursors. The precursors are useful for deposition of ge2sb2te5 chalcogenide thin films in the manufacture of nonvolatile phase change memory (pcm) or for the manufacturing of thermoelectric devices, by deposition techniques such as chemical vapor deposition (cvd) and atomic layer deposition (ald)..
07/24/14
20140206134
new patent Low temperature deposition of phase change memory materials
A system and method for forming a phase change memory material on a substrate, in which the substrate is contacted with precursors for a phase change memory chalcogenide alloy under conditions producing deposition of the chalcogenide alloy on the substrate, at temperature below 350° c., with the contacting being carried out via chemical vapor deposition or atomic layer deposition. Various tellurium, germanium and germanium-tellurium precursors are described, which are useful for forming gst phase change memory films on substrates..
07/24/14
20140206132
new patent Method for indium sputtering and for forming chalcopyrite-based solar cell absorber layers
Cuga layer are also provided and a thermal processing operation causes the selenization of the metal precursor layers. The thermal processing operation/selenization operation converts the metal precursor layers to an absorber layer.
07/24/14
20140205972
new patent Glass ceramic material and method
The present invention relates to a method for manufacturing of a glass ceramic material for dental applications. The method comprises: providing a first precursor comprising silicon(iv); providing a second precursor comprising zirconium(iv); hydrolyzing said first precursor and second precursor in solution; polymerizing of the hydrolysed first precursor and second precursor in a solvent, wherein polymers are formed; formation of colloids comprising said polymers; formation of a gel from said colloids; aging the gel; drying the gel; and sintering the gel under formation of a glass ceramic material..
07/24/14
20140205930
new patent Catalyst production method, electrode catalyst for fuel cell produced by this method, and catalyst production apparatus
A method for producing a catalyst supporting a metal or an alloy on a support, including: independently controlling a temperature of a first supercritical fluid to be first temperature, the first supercritical fluid containing a precursor of the metal or precursor of the alloy that is dissolved in a supercritical fluid; independently controlling a temperature of the support to be a second temperature higher than the temperature of the first supercritical fluid; and supplying the first supercritical fluid controlled to the first temperature to the support, to cause the metal or the alloy to be supported on the support.. .
07/24/14
20140205766
new patent Surface nanoreplication using polymer nanomasks
Methods for replicating a nanopillared surface include applying a nanopillar-forming material to a surface of a replica substrate to form a precursor layer on the replica-substrate surface. A template surface of a nanomask may be contacted to the precursor layer.
07/24/14
20140205756
new patent Iron pyrite thin films from molecular inks
Systems and methods are provided for fabricating pyrite thin films from molecular inks. A process is provided that comprises dissolving simple iron-bearing and sulfur-bearing molecules in an appropriate solvent and then depositing the solution onto an appropriate substrate using one of several methods (roll-to-roll coating, spraying, spin coating, etc.), resulting in a solid film consisting of the molecules.
07/24/14
20140205750
new patent Cathode active material coating
Embodiments of the present disclosure relate to apparatus and methods for forming particles of cathode active materials with a thin protective coating layer. The thin protective coating layer improves cycle and safety performance of the cathode active material.
07/24/14
20140205617
new patent Compositions and methods for treatment of neoplastic disease
The present invention comprises the use of sickle cells or sickle cell precursors loaded with a therapeutic agent that localize in tumors and induce a tumoricidal response.. .
07/24/14
20140205528
new patent Process for preparing a composition comprising synthetic mineral particles and composition
A process for preparing a composition including synthetic mineral particles, in which a hydrogel which is a precursor of the synthetic mineral particles is prepared via a coprecipitation reaction between at least one compound including silicon, and at least one compound including at least one metal element, characterized in that the coprecipitation reaction takes place in the presence of at least one carboxylate salt of formula r2—coom′ in which: —m′ denotes a metal chosen from the group made up of na and k, and —r2 is chosen from h and alkyl groups including fewer than 5 carbon atoms. A composition including synthetic mineral particles which is obtained by such a process is also described..
07/24/14
20140204159
new patent Mixed organosiloxane networks for tunable surface properties for blanket substrates for indirect printing methods
A crosslinked siloxane composition contains the polymerization product of a mixture containing from about 2 to about 12 alkoxysilane precursor materials, where at least one of the alkoxysilane precursor materials is a hydrophilic alkoxysilane precursor material, and at least one of the alkoxysilane precursor materials is a hydrophobic alkoxysilane precursor material. A method of printing an image to a substrate involves applying an inkjet ink to an intermediate transfer member using an inkjet printhead, spreading the ink onto the transfer member, inducing a property change of the ink, and transferring the ink to a substrate, where the intermediate transfer member comprises a crosslinked siloxane composition containing the polymerization product of a mixture comprising from about 2 to about 12 alkoxysilane precursor materials, where at least one of the precursor materials is hydrophilic and at least one is hydrophobic..
07/24/14
20140204030
new patent Mouse device
A mouse device includes a base and a displacement sensing device. The displacement sensing device includes a light-emitting element, an optical assembly, and an optical sensing element.
07/24/14
20140204026
new patent Synchronizing a cursor from a managed system with a cursor from a remote system
A method includes receiving reports of the pointing device events occurring on a remote computer at a host computer and performing computations in the host computer based upon the mouse reports. The method includes generating screen images in the host computer based upon the computations, the screen images not containing images of a cursor representing locations pointed to by a pointing device of the host computer.
07/24/14
20140204025
new patent Moving object detecting apparatus, moving object detecting method, pointing device, and storage medium
Even when a user is gazing at one point intentionally but the eyeball of the user is actually moving slightly, the slight movement is not reproduced as it is as the position of a cursor but a determination is made that the user is gazing at one point intentionally, that is, the eyeball is stopping. Thus, when a determination is made that the eyeball is stopping, the cursor is displayed still even when the gazing point is moving slightly depending on the slight movement.
07/24/14
20140203434
new patent Semiconductor integrated circuit and fabricating the same
A method of fabricating a semiconductor integrated circuit (ic) is disclosed. The method includes receiving a precursor.
07/24/14
20140202349
new patent Process for making lithographic printing plate
A process for making a lithographic printing plate enables a one-bath processable lithographic printing plate having excellent printing durability, ink laydown and resistance to staining during printing. The process includes a step of producing a negative-working lithographic printing plate precursor having, above a support, a photopolymerizable photosensitive layer containing a vinylcarbazole compound-derived monomer unit-containing acrylic polymer and/or a urethane-acrylic hybrid polymer, a step of image-wise exposing the negative-working lithographic printing plate precursor, and a step of developing the exposed negative-working lithographic printing plate precursor by means of a developer having a ph of 4 to 10, comprising (component a) a compound represented by formula (i) and/or formula (ii) below and (component b) water, and having an organic solvent content of less than 5 mass %.
07/24/14
20140202206
new patent Methods and equipment for treatment of odorous gas steams
A method for removing noxious, hazardous, toxic, mutagenic, and/or carcinogenic compounds and/or precursor compounds from a comingled gas, liquid and/or solid stream is described. In one embodiment, the method includes optionally passing the stream through an ambient temperature condenser followed by passing the stream through a spray venturi scrubber, a chilled condenser, a gas/solid separator, and a series of wet scrubbers to remove at least a portion of the compounds..
07/17/14
20140200659
Capping bioprosthetic tissue to reduce calcification
A treatment for bioprosthetic tissue used in implants or for assembled bioprosthetic heart valves to reduce in vivo calcification. The method includes applying a calcification mitigant such as a capping agent or an antioxidant to the tissue to specifically inhibit oxidation in tissue.
07/17/14
20140200349
Manganese containing hydrosilylation catalysts and compositions containing the catalysts
A composition contains (a) a hydrosilylation reaction catalyst and (b) an aliphatically unsaturated compound having an average, per molecule, of one or more aliphatically unsaturated organic groups capable of undergoing hydrosilylation reaction. The composition is capable of reacting via hydrosilylation reaction to form a reaction product, such as a silane, a gum, a gel, a rubber, or a resin.
07/17/14
20140200348
Vanadium containing hydrosilylation catalysts and compositions containing the catalysts
A composition contains (a) a hydrosilylation reaction catalyst and (b) an aliphatically unsaturated compound having an average, per molecule, of one or more aliphatically unsaturated organic groups capable of undergoing hydrosilylation reaction. The composition capable of reacting via hydrosilylation reaction to form a reaction product, such as a silane, a gum, a gel, a rubber, or a resin.
07/17/14
20140200347
Rhenium containing hydrosilylation catalysts and compositions containing the catalysts
A composition contains (a) a hydrosilylation reaction catalyst and (b) an aliphatically unsaturated compound having an average, per molecule, of one or more aliphatically unsaturated organic groups capable of undergoing hydrosilylation reaction. The composition capable of reacting via hydrosilylation reaction to form a reaction product, such as a silane, a gum, a gel, a rubber, or a resin.
07/17/14
20140200345
Production method for 2-alkenylamine compound
Provided is a method for producing a 2-alkenylamine compound efficiently and at low cost, using a primary or secondary amine compound and a 2-alkenyl compound as the starting materials therefor. The 2-alkenyleamine compound is produced by 2-alkenylating a primary or secondary amine compound, using a specified 2-alkenylating agent and in the presence of a catalyst comprising a complexing agent and a transition metal precursor stabilized by a monovalent anionic five-membered conjugated diene..
07/17/14
20140200313
Method for preparing dialkyl magnesium compounds by ethylene polymerisation and uses thereof
A process for the preparation by ethylene polymerization of at least one dialkyl magnesium compound of formula r—(ch2—ch2)n—mg—(ch2—ch2)m—r′ in which r and r′, identical or different, represent aryl, benzyl, allyl or alkyl groups and in which the integers n and m, identical or different, represent average —ch2—ch2— chain formation numbers greater than 1, the process including a single stage of mixing the following components: at least one ligand or one ligand precursor, at least one rare earth salt, at least one dialkyl magnesium compound of formula r—mg—r′, and ethylene, in a medium allowing contact between the components of the above mixture.. .
07/17/14
20140200300
Precursor polyelectrolyte complexes compositions
The invention relates to compositions and methods of treatment employing compositions comprising polyelectrolyte complexes. The compositions include a water-soluble first polyelectrolyte bearing a net cationic charge or capable of developing a net cationic charge and a water-soluble second polyelectrolyte bearing a net anionic charge or capable of developing a net anionic charge.
07/17/14
20140200201
Enzymatic production or chemical synthesis and uses for 5,7-dienes and uvb conversion products thereof
Provided herein are steroidal compounds that are androsta-5,7-dienes or a pregna-5,7-dienes and ultraviolet b (uvb) conversion products thereof which includes pharmaceutical compositions of the steroidal compounds as shown in tables 1 and 2. Also provided is a method for producing hydroxylated metabolites of cholecalciferol or ergocalciferol via the p450scc (cyp11a1) or cyp27b1 enzyme systems where the hydroxylase has an activity to hydroxylate position c20 of a secosteroid or its 5,7-dieneal precursor and the hydroxylated metabolites so produced.
07/17/14
20140199915
Novel enhanced filamentous silicone products and processes
Filamentous bodies which are longitudinally extended and other film-like constructions are made by combining liquid siliceous precursors with air and extruding them. Distinct types or grades of fibers, strands, and other film-like constructions are produced which have a multiplicity of useful applications and indications for use owing to their inherent memory, compactability, tensile strength and density.
07/17/14
20140199850
Dry-etch for selective oxidation removal
Methods of selectively etching tungsten oxide relative to tungsten, silicon oxide, silicon nitride and/or titanium nitride are described. The methods include a remote plasma etch formed from a fluorine-containing precursor and/or hydrogen (h2).
07/17/14
20140199800
Luminescent materials that emit light in the visible range or the near infrared range and methods of forming thereof
Luminescent materials and methods of forming such materials are described herein. A method of forming a luminescent material includes: (1) providing a source of a and x, wherein a is selected from at least one of elements of group 1, and x is selected from at least one of elements of group 17; (2) providing a source of b, wherein b is selected from at least one of elements of group 14; (3) subjecting the source of a and x and the source of b to vacuum deposition to form a precursor layer over a substrate; (4) forming an encapsulation layer over the precursor layer to form an assembly of layers; and (5) heating the assembly of layers to a temperature theat to form a luminescent material within the precursor layer..
07/17/14
20140199478
Method for producing carbon membrane
Provided is a method of producing a carbon membrane including dipping a porous support in a suspension of a phenolic resin or a suspension of a phenolic resin precursor, drying the resulting support to form a membrane made of the phenolic resin or the phenolic resin precursor, and heat treating and thereby carbonizing the resulting membrane into a carbon membrane.. .
07/17/14
20140199402
Novel compounds for the treatment of inflammatory bowel disease
The present invention relates to a nucleic acid molecule of up to 150 nucleotides comprising consecutively from 5′ to 3′ (a) a first part whose sequence is between 50% and 100% complementary to the sequence aaaagcuggguugagagggcga; (b) a second part capable of forming a loop between the first and the third part; and (c) a third part comprising or consisting of the sequence aaaagcuggguugagagggcga; for use as a medicament. The present invention further relates to a nucleic acid molecule of up to 25 nucleotides comprising the sequence aaaagcuggguugagagggcga, for use as a medicament.
07/17/14
20140199278
Brown adipocyte modification
Methods and therapeutics are provided for treating metabolic disorders by increasing activation of brown adipose tissue. Generally, the methods and therapeutics can increase activation of brown adipose tissue to increase energy expenditure and induce weight loss.
07/17/14
20140198050
Multifunction touch keyboard module
A multifunction touch keyboard module includes a touch panel. The touch panel includes an ordinary area and a function area.
07/17/14
20140198040
Apparatus, system and method for self-calibration of indirect pointing devices
An apparatus, system, and method are disclosed for pointing device calibration. An observation module may track physical movement sensed by an indirect pointing device and record actual cursor behavior corresponding to the physical movement.
07/17/14
20140197583
Ceramic composition and ceramic injection-molding process
A ceramic composition for an injection-molding process for producing a combustion chamber pressure sensor, in particular for producing an insulation punch of a combustion chamber pressure sensor, includes a ceramic component in a proportion of greater than or equal to 50% by weight and a glass component in a proportion of less than or equal to 50% by weight. The ceramic component includes aluminum oxide.
07/17/14
20140197351
Lithium-ion-conducting materials
Lithium-ion-conducting ceramic materials are disclosed having characteristics of high lithium-ion conductivity at low temperatures, good current efficiency, and stability in water and corrosive media under static and electrochemical conditions. Some general formulas for the lithium-ion-conducting materials include mi1+x+z-δmiiixmivaymivb2-x-ymvzp3-zo12 and mi1+x+4z-δmiiixmivaymivb2-x-y-zp3o12, wherein mi comprises li, na, or mixtures thereof; 0.05<x<0.5, 0.05<y<2, 0≦z<3, and 0≦δ<0.5; miii comprises al, hf, sc, y, la, or mixtures thereof; miva comprises zr, ge, sn, or mixtures thereof; mivb comprises ti; and mv comprises si, ge, sn, or mixtures thereof.
07/17/14
20140196222
Conditioning dyeing agent for keratinous fibers
The specification describes an agent for coloring keratinic fibers. The agent includes, in a cosmetically acceptable carrier, at least one oxidation dye precursor, a precursor of a nature-analogous dye, a substantive dye, or combinations thereof.
07/10/14
20140195989
Input device, display device and method of controlling thereof
Exemplary embodiments may disclose an input device, a display device, and methods of controlling thereof. More particularly, exemplary embodiments may disclose an input device, a display device, and methods of controlling thereof, which inputs a command using gestures.
07/10/14
20140195986
Contactless remote control system and method for medical devices
The present invention provides a contactless remote control system enabling an operator to operate one or more medical devices in a contactless way, said remote control system comprising a display device for displaying a graphic user interface gui regarding the one or more medical devices; a tracking device for tracking the motion information of the operator; a control device for (1) interpreting the motion information of the operator into operation information relating to the movement trajectory of a cursor in the gui or the confirmation of the selection of an item in the gui where the cursor locates, and for (2) operating the gui in accordance with the operation information so as to generate control commands for the one or more medical devices; and an output device for outputting the control commands to the one or more medical devices. This system of the present invention enables the operator to operate and control the medical device in a more convenient way, and causes the degree of user satisfaction to be improved..
07/10/14
20140195985
Display apparatus, ui display method thereof and computer-readable recording medium
A display apparatus which corrects input characters by moving a cursor in word units is provided. The display apparatus includes a communication interface configured to receive a control command for a character input from a control device, a display configured to display characters corresponding to the control command, and a controller configured to control the display to move a cursor in word units when a correction command to correct the displayed characters is received..
07/10/14
20140195978
Granular graphical user interface element
A graphical user interface (gui) element permits a user to control an application in both a coarse manner and a fine manner. When a cursor is moved to coincide or overlap the displayed gui element, parameter adjustment is made at a first (coarse) granularity so that rapid changes to the target parameter can be made (e.g., displayed zoom level, image rotation or playback volume).
07/10/14
20140194887
Device, composition and method for prevention of bone fracture and pain
Methods, apparatus, compositions for reinforcing bone structures are disclosed as well as a reinforced bone structure itself. By injecting a low viscosity polymeric solution into a trabecular bone region at least partly surrounded by cortical bone allowing it to cross-link in-situ, a non-degradable gel can effectively reinforce the region by retaining fluid in the constrained space within the cortical shell.
07/10/14
20140194638
Spirobenzylamine-phosphine, preparation method therefor and use thereof
The present invention relates to a spirobenzylamine-phosphine, preparation method therefor and use thereof. The compound has a structure represented by formula (i), wherein n=0 to 3; r1, r2, r3, r4, r5, r6, r7, r8 and r9 having a value as defined in claim 1.
07/10/14
20140194627
Zinc containing hydrosilylation catalysts and compositions containing the catalysts
A composition contains (a) a hydrosilylation reaction catalyst and (b) an aliphatically unsaturated compound having an average, per molecule, of one or more aliphatically unsaturated organic groups capable of undergoing hydrosilylation reaction. The composition capable of reacting via hydrosilylation reaction to form a reaction product, such as a silane, a gum, a gel, a rubber, or a resin.
07/10/14
20140194620
18f-labeled precursor of pet radioactive medical supplies, and preparation method thereof
The present invention relates to a precursor of positron emission tomography (pet) radioactive medical supplies, a preparation method thereof, and an application thereof, and more specifically, to a precursor having a tetravalent organic salt leaving group, a preparation method, and a method for preparing desired pet radioactive medical supplies in a high radiochemical yield within a short preparation time by introducing 18f using the same through a single step. The precursor having a tetravalent organic salt leaving group of the present invention can simplify the known complex multistep preparation of radioactive medical supplies into a single step, can save production costs because an excessive amount of a phase transfer catalyst is not required, facilitates separation of a compound after reaction, and enables rapid reaction velocity.
07/10/14
20140194603
Method for the production of lignin-containing precursor fibres and also carbon fibres
The invention relates to a method for the production of a precursor for the production of carbon- and activated carbon fibres according to the wet- or air-gap spinning method, in which a solution of lignin and a fibre-forming polymer in a suitable solvent is extruded through the holes of a spinning nozzle into a coagulation bath, the formed thread is stretched and subsequently treated, dried at an elevated temperature and then wound up. The lignin-containing thread is an economical starting material for the production of carbon- and activated carbon fibres..
07/10/14
20140194572
Adhesive composition and easily dismantlable adhesive tape
The present invention provides an easily dismantlable adhesive composition as an adhesive composition containing an acrylic polymer (x) that contains a (meth)acrylate monomer as a main monomer component, and an acid catalyst or an acid generator, in which the acrylic polymer (x) contains a poly(meth)acrylate chain (a) that is formed of repeating units derived from a carboxyl precursor group-containing (meth)acrylate monomer (a), and a number of the repeating units is 10 or greater.. .
07/10/14
20140194546
Easily dismantlable adhesive composition and easily dismantlable adhesive tape
An easily dismantlable adhesive composition containing: an acrylic block polymer having a poly(meth)acrylate chain (a) formed of a carboxyl precursor group-containing (meth)acrylate monomer (a) and a poly(meth)acrylate chain (b) that contains, as monomer components, a (meth)acrylate (b) having an alkyl group having 1 to 14 carbon atoms and a polar group-containing monomer (c); and either an acid catalyst or an acid generator, makes it possible to achieve favorable adhesiveness and dismantlability and suppress stick-slip at the time of dismantlement.. .
07/10/14
20140194509
Hydroxybutyrate ester and medical use thereof
A compound which is 3-hydroxybutyl 3-hydroxybutyrate enantiomerically enriched with respect to (3r)-hydroxybutyl (3r)-hydroxybutyrate of formula (i) is an effective and palatable precursor to the ketone body (3r)-hydroxybutyrate and may therefore be used to treat a condition which is caused by, exacerbated by or associated with elevated plasma levels of free fatty acids in a human or animal subject, for instance a condition where weight loss or weight gain is implicated, or to promote alertness or improve cognitive function, or to treat, prevent or reduce the effects of neurodegeneration, free radical toxicity, hypoxic conditions or hyperglycaemia.. .
07/10/14
20140193983
Apparatuses and methods for depositing sic/sicn films via cross-metathesis reactions with organometallic co-reactants
Disclosed herein are methods of forming sic/sicn film layers on surfaces of semiconductor substrates. The methods may include introducing a silicon-containing film-precursor and an organometallic ligand transfer reagent into a processing chamber, adsorbing the silicon-containing film-precursor, the organometallic ligand transfer reagent, or both onto a surface of a semiconductor substrate under conditions whereby either or both form an adsorption-limited layer, and reacting the silicon-containing film-precursor with the organometallic ligand transfer reagent, after either or both have formed the adsorption-limited layer.
07/10/14
20140193910
Methods for producing pancreatic precursor cells and uses thereof
The present invention is directed to methods for readily propagating somatic pancreatic precursor cells. The methods comprise isolating cells from intact pancreatic samples and enhancing guanine nucleotide (gnp) biosynthesis in cultures comprising these cells, thereby expanding guanine nucleotide pools.
07/10/14
20140193752
Stabilized acid amplifiers
There are disclosed sulfonic acid precursor compositions, as are methods of using these compositions in, for example, photolithography. Other embodiments are also disclosed..
07/10/14
20140193647
Coatings for solar applications
The present invention discloses coating compositions comprising: i) at least one highly absorbing material selected from the group consisting of ruthenium, iridium and osmium compounds, and mixtures thereof; ii) an inorganic glass binder or a precursor thereof; iii) a ceramic filler comprising metal oxides, metal powders and mixtures thereof; and v) a liquid organic vehicle. The invention further discloses methods for preparing these coatings and uses thereof in solar applications..
07/10/14
20140193598
Multilayer adhesive film, in particular for bonding optical sensors
A multilayer pressure sensitive adhesive (psa) film having a first acrylic pressure sensitive adhesive layer and an opposing second acrylic pressure sensitive adhesive layer, wherein the first pressure sensitive adhesive layer has a glass transition temperature tg≧0° c. And a content of a strongly polar acrylate of 7.5 to 15 wt.-% in its precursor, and the second pressure sensitive adhesive layer has a tg≦0° c.
07/10/14
20140193585
Method for modifying probe tip
A method for modifying the probe tip of a microscope, including the following steps of providing a substrate, providing a metal precursor solution with fluoride ion on the substrate, using the probe tip to dip into the metal precursor solution with fluoride ion on the substrate in order to form a nano-metal particle on the probe tip by the reduction reaction of at least one metal ion in the metal precursor solution. As the result, the probe tip having the nano-metal particle thereon can increase the spatial-resolution of the measuring performance of the field sensitive scanning probe microscope due to the great reduction of stray field effects..
07/10/14
20140193579
Combination cvd/ald method and source
The present invention relates generally to methods and apparatus for the controlled growing of material on substrates. According to embodiments of the present invention, a precursor fed is split in to two paths from a precursor source.
07/10/14
20140193578
Splashguard and inlet diffuser for high vacuum, high flow bubbler vessel
The present invention is a bubbler having a diptube inlet ending in a bubble size reducing outlet and at least one baffle disc positioned between the outlet of the diptube and the outlet of the bubbler to provide a narrow annular space between the baffle disc and the wall of the bubbler to prevent liquid droplets from entering the outlet to the bubbler. The bubble size reducing outlet is an elongated cylindrical porous metal frit situated in a sump of approximately the same dimensions.
07/10/14
20140193522
Mixtures for producing chlorine dioxide gas in enclosures and methods of making the same
The present disclosure relates to a mixture for producing chlorine dioxide gas provided in an enclosure comprising an impregnate comprising a chlorine dioxide precursor impregnated in a porous carrier and a proton-generating species, wherein the impregnate and proton-generating species are intermixed to produce a stable mixture and the mixture is provided in an enclosure. The present disclosure also relates to methods for producing chlorine dioxide gas..
07/10/14
20140193499
Bioactive glass composition, its applications and respective preparation methods
The present invention relates to development of bioactive glass/glass-ceramic composition that are able to promote a fast deposition layer of carbonated hydroxyapatite upon immersion in simulated body fluid (sbf) for time periods as short as one hour. Such composition might include fluorides, and a variety of oxides (or their precursor compounds), such as na2o—ag2o—sro—cao—mgo—zno—p2o5—sio2—bi2o3—b2o3—caf2, be prepared by the melt route or by the sol-gel process, with the specific composition and the preparation route selected according to the intended functionalities, which can present controlled biodegradation rate and bactericidal activity.
07/10/14
20140193380
Technologies, methods, and products of small molecule directed tissue and organ regeneration from human pluripotent stem cells
Pluripotent human embryonic stem cells (hescs) hold great potential for restoring tissue and organ function, which has been hindered by inefficiency and instability of generating desired cell types through multi-lineage differentiation. This instant invention is based on the discovery that pluripotent hescs maintained under defined culture conditions can be uniformly converted into a specific lineage by small molecule induction.
07/10/14
20140193364
Tam receptor ligands, metabolites and precursors thereof in the detection and modulation of inflammatory neuropathological disease
The present disclosure relates to the use of tam receptor ligands, metabolites, precursor and binding partners thereof in the field of inflammatory neuropathology. This includes the early diagnosis and monitoring of an inflammatory neuropathology as well as screening for medicaments used in the treatment and prophylaxis of such a condition.


Popular terms: [SEARCH]



Follow us on Twitter
twitter icon@FreshPatents

###

This listing is a sample listing of patent applications related to Cursor for is only meant as a recent sample of applications filed, not a comprehensive history. There may be associated servicemarks and trademarks related to these patents. Please check with patent attorney if you need further assistance or plan to use for business purposes. This patent data is also published to the public by the USPTO and available for free on their website. Note that there may be alternative spellings for Cursor with additional patents listed. Browse our RSS directory or Search for other possible listings.
     SHARE
  
         


FreshNews promo



0.2729

3231

1 - 1 - 77