FreshPatents.com Logo
Enter keywords:  

Track companies' patents here: Public Companies RSS Feeds | RSS Feed Home Page
Popular terms

[SEARCH]

Bowel topics
Bowel Disease
Inflammatory Bowel Disease
Irritable Bowel Syndrome
Inflammation
Mercaptopurine
Probiotics
Abdominal Pain
Discomfort
Bowel Movement
Gastrointestinal
Ulcerative Colitis
Rheumatoid Arthritis
Jejunal Tube
Spring Mechanism
Small Bowel

Follow us on Twitter
twitter icon@FreshPatents

Web & Computing
Cloud Computing
Ecommerce
Search patents
Smartphone patents
Social Media patents
Video patents
Website patents
Web Server
Android patents
Copyright patents
Database patents
Programming patents
Wearable Computing
Webcam patents

Web Companies
Apple patents
Google patents
Adobe patents
Ebay patents
Oracle patents
Yahoo patents

[SEARCH]

Bowel patents



      
           
This page is updated frequently with new Bowel-related patent applications. Subscribe to the Bowel RSS feed to automatically get the update: related Bowel RSS feeds. RSS updates for this page: Bowel RSS RSS


Date/App# patent app List of recent Bowel-related patents
07/24/14
20140206694
 Heterocyclic compounds and their uses patent thumbnailHeterocyclic compounds and their uses
Substituted bicyclic heteroaryls and compositions containing them, for the treatment of general inflammation, arthritis, rheumatic diseases, osteoarthritis, inflammatory bowel disorders, inflammatory eye disorders, inflammatory or unstable bladder disorders, psoriasis, skin complaints with inflammatory components, chronic inflammatory conditions, including but not restricted to autoimmune diseases such as systemic lupus erythematosis (sle), myestenia gravis, rheumatoid arthritis, acute disseminated encephalomyelitis, idiopathic thrombocytopenic purpura, multiples sclerosis, sjoegren's syndrome and autoimmune hemolytic anemia, allergic conditions including all forms of hypersensitivity, the present invention also enables methods for treating cancers that are mediated, dependent on or associated with p110δ activity, including but not restricted to leukemias, such as acute myeloid leukaemia (aml) myelo-dysplastic syndrome (mds) myelo-proliferative diseases (mpd) chronic myeloid leukemia (cml) t-cell acute lymphoblastic leukaemia (t-all) b-cell acute lymphoblastic leukaemia (b-all) non hodgkins lymphoma (nhl) b-cell lymphoma and solid tumors, such as breast cancer.. .
07/24/14
20140206636
 Methods of diagnosing and treating small intestinal bacterial overgrowth (sibo) and sibo-related conditions patent thumbnailMethods of diagnosing and treating small intestinal bacterial overgrowth (sibo) and sibo-related conditions
Disclosed is a method of treating small intestinal bacterial overgrowth (sibo) or a sibo-caused condition in a human subject. Sibo-caused conditions include irritable bowel syndrome, fibromyalgia, chronic pelvic pain syndrome, chronic fatigue syndrome, depression, impaired mentation, impaired memory, halitosis, tinnitus, sugar craving, autism, attention deficit/hyperactivity disorder, drug sensitivity, an autoimmune disease, and crohn's disease.
07/17/14
20140199709
 Methods for diagnosing irritable bowel syndrome patent thumbnailMethods for diagnosing irritable bowel syndrome
The invention provides an elisa assay for the determination of serum mast cell β-tryptase levels using rabbit anti-tryptase as the capture antibody and alkaline phosphatase conjugated g3 as the detecting antibody. Luminescent substrate cpsd was used to enhance the assay sensitivity.
07/17/14
20140199402
 Novel compounds for the treatment of inflammatory bowel disease patent thumbnailNovel compounds for the treatment of inflammatory bowel disease
The present invention relates to a nucleic acid molecule of up to 150 nucleotides comprising consecutively from 5′ to 3′ (a) a first part whose sequence is between 50% and 100% complementary to the sequence aaaagcuggguugagagggcga; (b) a second part capable of forming a loop between the first and the third part; and (c) a third part comprising or consisting of the sequence aaaagcuggguugagagggcga; for use as a medicament. The present invention further relates to a nucleic acid molecule of up to 25 nucleotides comprising the sequence aaaagcuggguugagagggcga, for use as a medicament.
07/17/14
20140196207
 Impaired person care system and method patent thumbnailImpaired person care system and method
An impaired person care system which includes a reconfigurable powered wheelchair operating in conjunction with a segmented bed having a main bed section and multiple reconfigurable bed sections. The wheelchair has back, seat and leg sections configurable to an upright sitting position or a horizontal lying-down bed resting position.
07/10/14
20140194698
 Abdominal retractor patent thumbnailAbdominal retractor
Devices and methods for retracting tissue, such as bowels and organs, within the body of a patient are generally disclosed. In particular, the present disclosure describes surgical retractors having a series of intersecting strands defining openings there between, wherein the openings are enlargeable by slidable passage of the strands relative to one another.
07/10/14
20140193408
 Soluble proteins for use as therapeutics patent thumbnailSoluble proteins for use as therapeutics
The present invention relates to improved binding proteins, for use as a medicament, in particular for the prevention or treatment of autoimmune and inflammatory disorders, for example allergic asthma and inflammatory bowel diseases. The invention more specifically relates to a soluble protein, comprising a complex of two heterodimers, wherein each heterodimer essentially consists of: (i) a first single chain polypeptide comprising: (a) an antibody heavy chain sequence having vh, ch1, ch2, and ch3 regions; and (b) a monovalent region of a mammalian binding molecule fused to the vh region; and (ii) a second single chain polypeptide comprising: (c) an antibody light chain sequence having a vl and cl region; and (d) a monovalent region of a mammalian binding molecule fused to the vl region; characterised in that each pair of vh and vl cdr sequences has specificity for an antigen, such that the total valency of said soluble protein is six.
07/10/14
20140193388
 Modified phosphatases patent thumbnailModified phosphatases
The invention relates to phosphatases and more in specific to (genetically) modified phosphatases, pharmaceutical compositions comprising (genetically) modified phosphatases and the use of (genetically) modified phosphatases for treating or curing for example sepsis, inflammatory bowel disease or other inflammatory diseases, or renal failure. The invention further relates to a method for producing phosphatases..
07/10/14
20140193332
 Compositions and methods for the diagnosis and treatment of inflammatory bowel disorders patent thumbnailCompositions and methods for the diagnosis and treatment of inflammatory bowel disorders
The present invention is directed to compositions of matter useful for the diagnosis and treatment of inflammatory bowel diseases in mammals and to methods of using those compositions of matter for the same.. .
07/03/14
20140187859
 Endoluminal introducer patent thumbnailEndoluminal introducer
An introducer for use during endoscopic procedures provides insufflation, washing, and aspiration functions, and provides for the protection of the endoluminal surface during laparoscopic examination of an anastomosis or suture line following low anterior resection of the bowel. The introducer may be designed for the insertion of an endoscope capable of white light and/or near infra-red fluorescence imaging into the rectum for analysis of an anastomosis following low anterior resection of the bowel..
07/03/14
20140187602
Anti-sense oligonucleotides targeted against exon 9 of il-23r alpha gene and method of using same to induce exon skipping and to treat inflammatory bowel diseases
The present invention relates to anti-sense oligonucleotides (aons) used to induce exon 9 skipping in il-23rαgene. Exon 9 skipping of the il23rα gene ultimately causes specific induction of a novel soluble truncated il-23rα (Δ9) protein, characterized by a lack in a transmembrane domain and has a unique eight (8) amino acids (glkegsyc) at its c-terminus end as a result of frame-shift.
07/03/14
20140187579
Tip60 inhibitors
This invention is in the fields of immunology and autoimmunity. More particularly it concerns pharmaceutical compositions comprising compounds which are useful agents for inhibiting the functions of tip60 and the use of such compounds in the treatment of an individual suffering, for example, from ulcerative colitis and other irritable bowel diseases..
07/03/14
20140187521
Amelioration of intestinal fibrosis and treatment of crohn's disease
Methods of treating patients with inflammatory bowel disease, intestinal fibrosis, or crohn's disease involve administering a therapeutic amount of card-024 or related compound.. .
07/03/14
20140187517
Method for treating intestinal diseases presenting at least one inflammatory component
The present disclosure relates to methods for treating intestinal diseases presenting at least one inflammatory component such as inflammatory bowel disease or diverticular disease and/or maintaining remission of intestinal diseases presenting at least one inflammatory component such as inflammatory bowel disease (ibd) or diverticular disease using budesonide mmx compositions.. .
07/03/14
20140187490
Val (8) glp-1 composition and method for treating functional dyspepsia and/or irritable bowel syndrome
A method of treating functional dyspepsia and/or irritable bowel syndrome in mammals in need of treatment is disclosed herein. The method comprises administering to the mammal a formulation by inhalation, wherein the formulation avoids first pass metabolism of the active ingredient.
07/03/14
20140186450
Gastroresistant pharmaceutical formulations containing rifaximin
The object of the invention consists of pharmaceutical formulations containing rifaximin in the shape of microgranules made gastroresistant by an insoluble polymer at ph values between 1.5 and 4.0 and soluble at ph values between 5.0 and 7.5, by their preparation and by their use in the manufacture of medicinal preparations useful in the treatment of inflammatory bowel diseases (ibd) and mainly crohn's disease.. .
06/26/14
20140179693
Methods for treating vascular leak syndrome
Disclosed are methods for treating vascular leak syndrome. Further disclosed are methods for treating vascular leakage due to inflammatory diseases, inter alia, sepsis, lupus, inflammatory bowel disease.
06/26/14
20140179620
Gene expression markers for inflammatory bowel disease
The present invention relates to methods of gene expression profiling for inflammatory bowel disease pathogenesis, in which the differential expression in a test sample from a mammalian subject of one or more ibd markers relative to a control is determined, wherein the differential expression in the test sample is indicative of an ibd in the mammalian subject from which the test sample was obtained.. .
06/26/14
20140179549
Methods for identifying inflammatory bowel disease patients with dysplasia or cancer
The present invention provides methods for identifying ibd patients with dysplasia or cancer. In particular embodiments, the methods of the invention may comprise determining the presence or level of at least one or a panel of mirnas in a sample obtained from an ibd patient to establish a mirna expression profile, and comparing the mirna expression profile with one or more pre-established model mirna expression profiles.
06/26/14
20140179537
Compositions and methods for diagnosing colon disorders
The present invention relates to methods and compositions for diagnosing, monitoring, prognosticating, analyzing, etc., polymicrobial diseases. The present invention also relates to the microbial community present in the digestive tract and lumen in normal subjects, and subjects with digestive tract diseases, especially diseases of the colon, such as inflammatory bowel disease, including ulcerative colitis, crohn's syndrome, and pouchitis.
06/26/14
20140178492
Bowel cleansing composition
The invention provides compositions for rapid bowel cleansing comprising a water-soluble mixture of polyethylene glycol and sodium phosphate(s). The compositions are particularly useful for preparing the bowel prior to surgery or diagnostic procedures such as colonoscopies.
06/26/14
20140178404
Use of neuregulin-4 for treatment of inflammatory bowel disease and necrotizing enterocolitis
The invention provides methods, pharmaceutical compositions and kits for treating, inhibiting and/or reducing the severity of inflammatory bowel disease and necrotizing enterocolitis in a subject in need thereof by administering an effective amount of a composition comprising an activator of erbb4.. .
06/26/14
20140175018
Diagnosing and treating inflammatory diseases
A method of diagnosing, monitoring progression of, or monitoring treatment of inflammatory bowel disease comprises determining the levels of cd14+hla-drhi monocytes or monocytes expressing ccr7 or ccr9 or both ccr7 and ccr9 in a sample obtained from a subject, wherein high levels of cd14+hla-drhi monocytes or monocytes expressing ccr7 or ccr9 or both ccr7 and ccr9, or increased levels of cd14+hla-drhi monocytes or monocytes expressing ccr7 or ccr9 or both ccr7 and ccr9 compared to control, indicate the presence or progression of inflammatory bowel disease. Similar methods for diagnosing irritable bowel syndrome are also described.
06/19/14
20140170178
Msi-specific frameshift peptides (fsp) for prevention and treatment of cancer
Described is a vaccine for prevention and treatment of cancer characterized by microsatellite instability (msi). The vaccine contains an msi-specific frameshift peptide (fsp) generating humoral and cellular responses against tumor cells or a nucleic acid encoding said fsp.
06/19/14
20140170173
Method of inducing immune tolerance comprising administering carbonic anhydrase i
The purpose of the present invention is to provide a method for treating autoimmune diseases. Disclosed is a method or the like for the treatment of autoimmune diseases, which utilizes an antigen-specific tolerogenic antigen presenting cell.
06/12/14
20140162963
Treatment of constipation-predominant irritable bowel syndrome
The invention provides methods for treating a patient with constipation-predominant irritable bowel syndrome by administering a therapeutically effective dose of linaclotide.. .
06/05/14
20140154275
Gene expression markers for crohn's disease
The present invention relates to methods of gene expression profiling for inflammatory bowel disease pathogenesis, in which the differential expression in a test sample from a mammalian subject of one or more ibd markers relative to a control is determined, wherein the differential expression in the test sample is indicative of an ibd in the mammalian subject from which the test sample was obtained.. .
06/05/14
20140154214
Selective glucagon-like-peptide-2 (glp-2) analogues
Glp-2 analogues are disclosed which comprise one of more substitutions as compared to h[gly2]glp-2 and which may have the property of an increased small intestine/colon and stomach/colon selectivity. More particularly, preferred glp-2 analogues disclosed herein comprise substitutions at one or more of positions 11, 16, 20, 24 and/or 28 of the wild-type glp-2 sequence, optionally in combination with further substitutions at position 2 and one or more of positions 3, 5, 7, and 10, and/or a deletion of one or more of amino acids 31 to 33 and/or the addition of a n-terminal or c-terminal stabilizing peptide sequence.


Popular terms: [SEARCH]

Bowel topics: Bowel Disease, Inflammatory Bowel Disease, Irritable Bowel Syndrome, Inflammation, Mercaptopurine, Probiotics, Abdominal Pain, Discomfort, Bowel Movement, Gastrointestinal, Ulcerative Colitis, Rheumatoid Arthritis, Jejunal Tube, Spring Mechanism, Small Bowel

Follow us on Twitter
twitter icon@FreshPatents

###

This listing is a sample listing of patent applications related to Bowel for is only meant as a recent sample of applications filed, not a comprehensive history. There may be associated servicemarks and trademarks related to these patents. Please check with patent attorney if you need further assistance or plan to use for business purposes. This patent data is also published to the public by the USPTO and available for free on their website. Note that there may be alternative spellings for Bowel with additional patents listed. Browse our RSS directory or Search for other possible listings.
     SHARE
  
         


FreshNews promo



0.2515

3741

449500 - 0 - 74