FreshPatents.com Logo
Enter keywords:  

Track companies' patents here: Public Companies RSS Feeds | RSS Feed Home Page
Popular terms

[SEARCH]

Bowel topics
Bowel Disease
Inflammatory Bowel Disease
Irritable Bowel Syndrome
Inflammation
Mercaptopurine
Probiotics
Abdominal Pain
Discomfort
Bowel Movement
Gastrointestinal
Ulcerative Colitis
Rheumatoid Arthritis
Jejunal Tube
Spring Mechanism
Small Bowel

Follow us on Twitter
twitter icon@FreshPatents

Web & Computing
Cloud Computing
Ecommerce
Search patents
Smartphone patents
Social Media patents
Video patents
Website patents
Web Server
Android patents
Copyright patents
Database patents
Programming patents
Wearable Computing
Webcam patents

Web Companies
Apple patents
Google patents
Adobe patents
Ebay patents
Oracle patents
Yahoo patents

[SEARCH]

Bowel patents



      
           
This page is updated frequently with new Bowel-related patent applications. Subscribe to the Bowel RSS feed to automatically get the update: related Bowel RSS feeds. RSS updates for this page: Bowel RSS RSS


Date/App# patent app List of recent Bowel-related patents
08/14/14
20140227711
 Genotoxicity as a biomarker for inflammation patent thumbnailGenotoxicity as a biomarker for inflammation
The invention provides a method for detection of inflammatory disease in a subject that comprises assaying a test sample of peripheral blood from the subject for a marker of dna damage. An elevated amount of marker present in the test sample compared to control sample is indicative of inflammatory disease activity, including sub-clinical inflammation.
08/07/14
20140221384
 Tetra-o-substituted butane-bridge modified ndga derivatives, their synthesis and pharmaecutical use patent thumbnailTetra-o-substituted butane-bridge modified ndga derivatives, their synthesis and pharmaecutical use
The present invention relates to nordihydroguaiaretic acid derivative compounds, namely, butane bridge modified nordihydroguaiaretic acid (ndga) compounds and butane bridge modified tetra-o-substituted ndga compounds, pharmaceutical compositions containing them, methods of making them, and methods of using them and kits including them for the treatment of diseases and disorders, in particular, diseases resulting from or associated with a virus infection, such as hiv infection, hpv infection, or hsv infection, an inflammatory disease, such as various types of arthritis and inflammatory bowel diseases, metabolic diseases, such as diabetes and hypertension, or a proliferative disease, such as diverse types of cancers.. .
08/07/14
20140221287
 Amylin peptides and derivatives and uses thereof patent thumbnailAmylin peptides and derivatives and uses thereof
There are provided polypeptide conjugates having enhanced duration of biological activity, and methods of use thereof. The polypeptide conjugates include duration enhancing moieties, including water soluble polymers, bound to the polypeptide components of defined sequence.
08/07/14
20140220012
 Novel vista-ig constructs and the use of vista-ig for treatment of autoimmune, allergic and inflammatory disorders patent thumbnailNovel vista-ig constructs and the use of vista-ig for treatment of autoimmune, allergic and inflammatory disorders
The present invention relates to a fusion proteins comprising regulatory t cell protein, vista (v-domain immunoglobulin suppressor of t cell activation (pd-l3) and an immunoglobulin protein (ig), preferably also containing a flexible linker intervening the vista and ig fc polypeptide. The invention also provides the use of vista polypeptides, multimeric vista polypeptides, vista-conjugates (e.g., vista-ig), and vista antagonists for the treatment of autoimmune disease, allergy, and inflammatory conditions, especially lupus, multiple sclerosis, psoriasis, psoriatic arthritis, multiple sclerosis, crohn's disease, inflammatory bowel disease and type 1 or type 2 diabetes..
07/31/14
20140213647
 Compound useful for preventing or treating irritable bowel syndrome and composition including same patent thumbnailCompound useful for preventing or treating irritable bowel syndrome and composition including same
The present invention provides a compound of formula (i) or a prodrug thereof useful for treating or preventing irritable bowel syndrome, and a composition comprising the compound as an active ingredient. Also, the present invention provides a method for treating or preventing irritable bowel syndrome, which comprises administrating a therapeutically or prophylactically effective amount of the compound or the composition to a subject in need of treating or preventing irritable bowel syndrome..
07/31/14
20140213521
 Oral treatment of inflammatory bowel disease patent thumbnailOral treatment of inflammatory bowel disease
The present invention relates to treatment of an inflammatory bowel disease by simultaneous or successive parental and oral administration of a mammalian beta defensin.. .
07/31/14
20140213518
 Methods of enhancing functioning of the large intestine patent thumbnailMethods of enhancing functioning of the large intestine
The invention relates to glucagon-related peptides and their use for the prevention or treatment of disorders involving the large intestine. In particular, it has now been demonstrated that glp-2 and peptidic agonists of glp-2 can cause proliferation of the tissue of large intestine.
07/24/14
20140206694
 Heterocyclic compounds and their uses patent thumbnailHeterocyclic compounds and their uses
Substituted bicyclic heteroaryls and compositions containing them, for the treatment of general inflammation, arthritis, rheumatic diseases, osteoarthritis, inflammatory bowel disorders, inflammatory eye disorders, inflammatory or unstable bladder disorders, psoriasis, skin complaints with inflammatory components, chronic inflammatory conditions, including but not restricted to autoimmune diseases such as systemic lupus erythematosis (sle), myestenia gravis, rheumatoid arthritis, acute disseminated encephalomyelitis, idiopathic thrombocytopenic purpura, multiples sclerosis, sjoegren's syndrome and autoimmune hemolytic anemia, allergic conditions including all forms of hypersensitivity, the present invention also enables methods for treating cancers that are mediated, dependent on or associated with p110δ activity, including but not restricted to leukemias, such as acute myeloid leukaemia (aml) myelo-dysplastic syndrome (mds) myelo-proliferative diseases (mpd) chronic myeloid leukemia (cml) t-cell acute lymphoblastic leukaemia (t-all) b-cell acute lymphoblastic leukaemia (b-all) non hodgkins lymphoma (nhl) b-cell lymphoma and solid tumors, such as breast cancer.. .
07/24/14
20140206636
 Methods of diagnosing and treating small intestinal bacterial overgrowth (sibo) and sibo-related conditions patent thumbnailMethods of diagnosing and treating small intestinal bacterial overgrowth (sibo) and sibo-related conditions
Disclosed is a method of treating small intestinal bacterial overgrowth (sibo) or a sibo-caused condition in a human subject. Sibo-caused conditions include irritable bowel syndrome, fibromyalgia, chronic pelvic pain syndrome, chronic fatigue syndrome, depression, impaired mentation, impaired memory, halitosis, tinnitus, sugar craving, autism, attention deficit/hyperactivity disorder, drug sensitivity, an autoimmune disease, and crohn's disease.
07/17/14
20140199709
 Methods for diagnosing irritable bowel syndrome patent thumbnailMethods for diagnosing irritable bowel syndrome
The invention provides an elisa assay for the determination of serum mast cell β-tryptase levels using rabbit anti-tryptase as the capture antibody and alkaline phosphatase conjugated g3 as the detecting antibody. Luminescent substrate cpsd was used to enhance the assay sensitivity.
07/17/14
20140199402
Novel compounds for the treatment of inflammatory bowel disease
The present invention relates to a nucleic acid molecule of up to 150 nucleotides comprising consecutively from 5′ to 3′ (a) a first part whose sequence is between 50% and 100% complementary to the sequence aaaagcuggguugagagggcga; (b) a second part capable of forming a loop between the first and the third part; and (c) a third part comprising or consisting of the sequence aaaagcuggguugagagggcga; for use as a medicament. The present invention further relates to a nucleic acid molecule of up to 25 nucleotides comprising the sequence aaaagcuggguugagagggcga, for use as a medicament.
07/17/14
20140196207
Impaired person care system and method
An impaired person care system which includes a reconfigurable powered wheelchair operating in conjunction with a segmented bed having a main bed section and multiple reconfigurable bed sections. The wheelchair has back, seat and leg sections configurable to an upright sitting position or a horizontal lying-down bed resting position.
07/10/14
20140194698
Abdominal retractor
Devices and methods for retracting tissue, such as bowels and organs, within the body of a patient are generally disclosed. In particular, the present disclosure describes surgical retractors having a series of intersecting strands defining openings there between, wherein the openings are enlargeable by slidable passage of the strands relative to one another.
07/10/14
20140193408
Soluble proteins for use as therapeutics
The present invention relates to improved binding proteins, for use as a medicament, in particular for the prevention or treatment of autoimmune and inflammatory disorders, for example allergic asthma and inflammatory bowel diseases. The invention more specifically relates to a soluble protein, comprising a complex of two heterodimers, wherein each heterodimer essentially consists of: (i) a first single chain polypeptide comprising: (a) an antibody heavy chain sequence having vh, ch1, ch2, and ch3 regions; and (b) a monovalent region of a mammalian binding molecule fused to the vh region; and (ii) a second single chain polypeptide comprising: (c) an antibody light chain sequence having a vl and cl region; and (d) a monovalent region of a mammalian binding molecule fused to the vl region; characterised in that each pair of vh and vl cdr sequences has specificity for an antigen, such that the total valency of said soluble protein is six.
07/10/14
20140193388
Modified phosphatases
The invention relates to phosphatases and more in specific to (genetically) modified phosphatases, pharmaceutical compositions comprising (genetically) modified phosphatases and the use of (genetically) modified phosphatases for treating or curing for example sepsis, inflammatory bowel disease or other inflammatory diseases, or renal failure. The invention further relates to a method for producing phosphatases..
07/10/14
20140193332
Compositions and methods for the diagnosis and treatment of inflammatory bowel disorders
The present invention is directed to compositions of matter useful for the diagnosis and treatment of inflammatory bowel diseases in mammals and to methods of using those compositions of matter for the same.. .
07/03/14
20140187859
Endoluminal introducer
An introducer for use during endoscopic procedures provides insufflation, washing, and aspiration functions, and provides for the protection of the endoluminal surface during laparoscopic examination of an anastomosis or suture line following low anterior resection of the bowel. The introducer may be designed for the insertion of an endoscope capable of white light and/or near infra-red fluorescence imaging into the rectum for analysis of an anastomosis following low anterior resection of the bowel..
07/03/14
20140187602
Anti-sense oligonucleotides targeted against exon 9 of il-23r alpha gene and method of using same to induce exon skipping and to treat inflammatory bowel diseases
The present invention relates to anti-sense oligonucleotides (aons) used to induce exon 9 skipping in il-23rαgene. Exon 9 skipping of the il23rα gene ultimately causes specific induction of a novel soluble truncated il-23rα (Δ9) protein, characterized by a lack in a transmembrane domain and has a unique eight (8) amino acids (glkegsyc) at its c-terminus end as a result of frame-shift.
07/03/14
20140187579
Tip60 inhibitors
This invention is in the fields of immunology and autoimmunity. More particularly it concerns pharmaceutical compositions comprising compounds which are useful agents for inhibiting the functions of tip60 and the use of such compounds in the treatment of an individual suffering, for example, from ulcerative colitis and other irritable bowel diseases..
07/03/14
20140187521
Amelioration of intestinal fibrosis and treatment of crohn's disease
Methods of treating patients with inflammatory bowel disease, intestinal fibrosis, or crohn's disease involve administering a therapeutic amount of card-024 or related compound.. .
07/03/14
20140187517
Method for treating intestinal diseases presenting at least one inflammatory component
The present disclosure relates to methods for treating intestinal diseases presenting at least one inflammatory component such as inflammatory bowel disease or diverticular disease and/or maintaining remission of intestinal diseases presenting at least one inflammatory component such as inflammatory bowel disease (ibd) or diverticular disease using budesonide mmx compositions.. .
07/03/14
20140187490
Val (8) glp-1 composition and method for treating functional dyspepsia and/or irritable bowel syndrome
A method of treating functional dyspepsia and/or irritable bowel syndrome in mammals in need of treatment is disclosed herein. The method comprises administering to the mammal a formulation by inhalation, wherein the formulation avoids first pass metabolism of the active ingredient.
07/03/14
20140186450
Gastroresistant pharmaceutical formulations containing rifaximin
The object of the invention consists of pharmaceutical formulations containing rifaximin in the shape of microgranules made gastroresistant by an insoluble polymer at ph values between 1.5 and 4.0 and soluble at ph values between 5.0 and 7.5, by their preparation and by their use in the manufacture of medicinal preparations useful in the treatment of inflammatory bowel diseases (ibd) and mainly crohn's disease.. .
06/26/14
20140179693
Methods for treating vascular leak syndrome
Disclosed are methods for treating vascular leak syndrome. Further disclosed are methods for treating vascular leakage due to inflammatory diseases, inter alia, sepsis, lupus, inflammatory bowel disease.
06/26/14
20140179620
Gene expression markers for inflammatory bowel disease
The present invention relates to methods of gene expression profiling for inflammatory bowel disease pathogenesis, in which the differential expression in a test sample from a mammalian subject of one or more ibd markers relative to a control is determined, wherein the differential expression in the test sample is indicative of an ibd in the mammalian subject from which the test sample was obtained.. .
06/26/14
20140179549
Methods for identifying inflammatory bowel disease patients with dysplasia or cancer
The present invention provides methods for identifying ibd patients with dysplasia or cancer. In particular embodiments, the methods of the invention may comprise determining the presence or level of at least one or a panel of mirnas in a sample obtained from an ibd patient to establish a mirna expression profile, and comparing the mirna expression profile with one or more pre-established model mirna expression profiles.
06/26/14
20140179537
Compositions and methods for diagnosing colon disorders
The present invention relates to methods and compositions for diagnosing, monitoring, prognosticating, analyzing, etc., polymicrobial diseases. The present invention also relates to the microbial community present in the digestive tract and lumen in normal subjects, and subjects with digestive tract diseases, especially diseases of the colon, such as inflammatory bowel disease, including ulcerative colitis, crohn's syndrome, and pouchitis.


Popular terms: [SEARCH]

Bowel topics: Bowel Disease, Inflammatory Bowel Disease, Irritable Bowel Syndrome, Inflammation, Mercaptopurine, Probiotics, Abdominal Pain, Discomfort, Bowel Movement, Gastrointestinal, Ulcerative Colitis, Rheumatoid Arthritis, Jejunal Tube, Spring Mechanism, Small Bowel

Follow us on Twitter
twitter icon@FreshPatents

###

This listing is a sample listing of patent applications related to Bowel for is only meant as a recent sample of applications filed, not a comprehensive history. There may be associated servicemarks and trademarks related to these patents. Please check with patent attorney if you need further assistance or plan to use for business purposes. This patent data is also published to the public by the USPTO and available for free on their website. Note that there may be alternative spellings for Bowel with additional patents listed. Browse our RSS directory or Search for other possible listings.
     SHARE
  
         


FreshNews promo



0.1907

3823

2 - 1 - 75