Follow us on Twitter
twitter icon@FreshPatents


Antagonist patents

      

This page is updated frequently with new Antagonist-related patent applications.




 Antagonists of slc38a9 and their use in therapy patent thumbnailAntagonists of slc38a9 and their use in therapy
The present invention relates to an antagonist or modulator of slc38a9 for use in treating a disease associated with mtorc1 activation, like a proliferative disease (e.g. A cancerous disease or benign proliferative disease), a metabolic disorder, a disorder of the immune system, a disorder causing premature aging, an ophthalmic disorder or a neurological disorder.
Cemm - Forschungzentrum Fuer Molekulare Medizin Gmbh


 Methods for treating visceral pain by administering antagonist antibodies directed against calcitonin gene-related peptide patent thumbnailMethods for treating visceral pain by administering antagonist antibodies directed against calcitonin gene-related peptide
The invention features methods for preventing or treating visceral pain, including pain associated with functional bowel disorder, inflammatory bowel disease and interstitial cystitis, by administering an anti-cgrp antagonist antibody.. .
Labrys Biologics, Inc.


 Vegf antagonist formulations patent thumbnailVegf antagonist formulations
Formulations of a vascular endothelial growth factor (vegf)-specific fusion protein antagonist are provided including a pre-lyophilized formulation, a reconstituted lyophilized formulation, and a stable liquid formulation. Preferably, the fusion protein has the sequence of seq id no:4..
Regeneron Pharmaceuticals, Inc.


 Novel anti-malignant tumor agent patent thumbnailNovel anti-malignant tumor agent
The present invention provides an antitumor agent having high safety, which is a molecular target drug against malignant tumors. An anti-malignant tumor agent characterized by containing, as an active ingredient, a substance targeting ribosomal proteins shows increased expression in malignant tumor cells.
National University Corporation Okayama University


 Substituted cyclopentanes, tetrahydrofuranes and pyrrolidines as orexin receptor antagonists patent thumbnailSubstituted cyclopentanes, tetrahydrofuranes and pyrrolidines as orexin receptor antagonists
The present invention provides compounds of formula (i) and pharmaceutically acceptable salts thereof, formula (i) wherein l, x, ra, rb, r1, r2 and r3 are as defined in the specification, processes for their preparation, pharmaceutical compositions containing them and their use in therapy.. .
Takeda Pharmaceutical Company Limited


 Combinations of nmdar modulating compounds patent thumbnailCombinations of nmdar modulating compounds
This disclosure features combinations of nmdar modulating compounds. This disclosure features combinations that include one or more nmdar antagonists and glyx-13 (each of which is sometimes referred to herein as a ‘component”).
Northwestern University


 Combination therapy for the treatment of cancer patent thumbnailCombination therapy for the treatment of cancer
Described are methods and compositions for treating cancer that include a dopamine receptor (dr) antagonist such as thioridazine and a chemotherapeutic agent. Optionally, the chemotherapeutic agent is a dna synthesis inhibitor such as cytarabine or a microtubule inhibitor such as paclitaxel or docetaxel.
Mcmaster University


 Fluorinated integrin antagonists patent thumbnailFluorinated integrin antagonists
The present invention relates to fluorinated compounds of formula i and methods of synthesizing these compounds. The present invention also relates to pharmaceutical compositions containing the fluorinated compounds of the invention, and methods of treating macular degeneration, diabetic retinopathy (dr), macular edema, diabetic macular edema (dme), and macular edema following retinal vein occlusion (rvo), by administering these compounds and pharmaceutical compositions to subjects in need thereof..
Scifluor Life Sciences, Inc.


 Bh4 antagonists and methods related thereto patent thumbnailBh4 antagonists and methods related thereto
The disclosure relates to bh4 inhibitors and therapeutic uses relates thereto. In certain embodiments, the disclosure relates to methods of treating or preventing cancer, such as lung cancer, comprising administering therapeutically effective amount of a pharmaceutical composition comprising a compound disclosed herein or pharmaceutically acceptable salt to a subject in need thereof..
The Board Of Regent Of The University Of Texas System


 Nicotinic receptor non-competitive antagonists patent thumbnailNicotinic receptor non-competitive antagonists
The present invention relates to compounds that modulate nicotinic receptors as non-competitive antagonists, methods for their synthesis, methods for use, and their pharmaceutical compositions.. .
Catalyst Biosciences, Inc.


Pharmaceutical composition for the treatment of dry eye

The invention relates to therapeutic compositions for the treatment of dry eye, more specifically to compositions comprising a trpm8 receptor agonist ligand. Furthermore, the invention relates to therapeutic compositions for the treatment of epiphora, more specifically to compositions comprising a trpm8 receptor antagonist..
Consejo Superior De Investigaciones CientÍficas C.s.l.c.

Nasal drug products and methods of their use

Drug products adapted for nasal delivery, comprising a pre-primed device filled with a pharmaceutical composition comprising an opioid receptor antagonist, are provided. Methods of treating opioid overdose or its symptoms with the inventive drug products are also provided..
Opiant Pharmaceuticals

Micrornas 206 and 21 cooperate to promote ras-extracellular signal-regulated kinase signaling by suppressing the translation of rasa1 and spred1

The present invention provides a method for inhibiting the ras-erk pathway by upregulation of rasa1 and spred1 mrnas in tumor cells by anti-mir treatment. The method includes wherein an anti-mir-206 binds to a nucleotide comprising the sequence uagcuuaucagacu (seq id no: 21), or to a nucleotide comprising the sequence uggaauguaaggaagugugugg (seq id no: 9).
West Virginia University

St2l antagonists and methods of use

The present invention relates to st2l antagonists, polynucleotides encoding the antagonists or fragments thereof, and methods of making and using the foregoing.. .
Janssen Biotech, Inc.

Solubility for target compounds

The present disclosure relates to compounds having an improved solubility thereby increasing their bioavailability, lower dosages, etc. The target compounds, may include but are not limited to, macrophage migration inhibitory factor (mif) inhibitors, epidermal growth factor receptor (egrf) inhibitors, kinase inhibitors and prodrugs of alpha4 beta1 and alpha4 beta7 integrin antagonists.
Aunova Medchem Llc

Mcl-1 antagonists

Provided herein are mcl-1 antagonist compositions and methods of treating g the compositions described herein.. .
The Royal Institution For The Advancement Of Learning/mcgill University

1,2-substituted cyclopentanes as orexin receptor antagonists

The present invention provides compounds of formula (i) and pharmaceutically acceptable salts thereof, (i) wherein l, x, ra, rb, r1, r2 and r3 are as defined in the specification, processes for their preparation, pharmaceutical compositions containing them and their use in therapy.. .
Takeda Pharmaceutical Company Limited

Enhancing the therapeutic activity of an immune checkpoint inhibitor

The present invention provides antagonists and methods of use thereof in the treatment of cancer and abnormal immune suppression diseases.. .
Maine Medical Center Research Institute

Use of cgrp antagonist compounds for treatment of psoriasis

A method for treating, remedying, or preventing psoriasis by administering a therapeutically effective dose of at least one cgrp antagonist compound in a pharmaceutically acceptable formulation. The method for treating, remedying, or preventing psoriasis by administering topically and to the pre-psoriatic rim a therapeutically effective dose of at least one cgrp antagonist compound in a pharmaceutically acceptable formulation..

Transdiscal administration of specific inhibitors of pro-inflammatory cytokines

The present invention relates to injecting a high specificity cytokine antagonist into a diseased intervertebral disc.. .
Depuy Synthes Products, Llc

C5ar antagonists

Compounds are provided that are modulators of the c5a receptor. The compounds are substituted piperidines and are useful in pharmaceutical compositions, methods for the treatment of diseases and disorders involving the pathologic activtation of c5a receptors..
Chemocentryx, Inc.

Compounds with trpv4 activity, compositions and associated methods thereof

Compounds, compositions and methods useful for treating ocular diseases are provided. In particular, antagonists of trpv4, their synthesis, pharmaceutical compositions thereof and methods of treating ocular diseases such as glaucoma, are disclosed..
University Of Utah Research Foundation

Methods of treating or preventing preterm labor

Described herein are methods for treating preterm labor, stopping labor prior to cesarean delivery, preventing preterm labor, or controlling the timing of parturition by administering a chemical compound, such as a muscarinic receptor antagonist preferably a m, receptor antagonist, or a β-3 adrenergic agonist. Also described are methods for treating preterm labor, stopping labor preparatory to cesarean delivers', preventing preterm labor, or controlling the timing of parturition by administering an effective amount of transdermal stimulation, posterior tibial nerve stimulation or another form of non-invasive or invasive neuromodulatton, unstimulated or stimulated acupuncture, magnetic field therapy, or vibratory stimulation.

Treatment with opioid antagonists and mtor inhibitors

Embodiments of the invention provide methods of treating a disorder or disease characterized by cellular proliferation and migration by co-administering a synergistically effective amount of an mtor inhibitor and a μ-opioid receptor antagonist.. .
The University Of Chicago

Use of nk-1 receptor antagonists in pruritus

The invention relates to methods for treating pruritus with nk-1 receptor antagonists such as serlopitant. The invention further relates to pharmaceutical compositions comprising nk-1 receptor antagonists such as serlopitant.
Menlo Therapeutics Inc.

Use of nk-1 receptor antagonist serlopitant in pruritus

The invention relates to methods for treating pruritus with nk-1 receptor antagonists such as serlopitant. The invention further relates to pharmaceutical compositions comprising nk-1 receptor antagonists such as serlopitant.
Menlo Therapeutics Inc.

Toll-like receptor 3 antagonists

Toll like receptor 3 (tlr3) antibody antagonists, polynucleotides encoding tlr3 antibody antagonists or fragments thereof, and methods of making and using the foregoing are disclosed.. .
Janssen Biotech, Inc.

Anti-cd40 antibodies

The present invention relates to new humanized antagonistic anti-cd40 antibodies and therapeutic and diagnostic methods and compositions for using the same.. .
Boehringer Ingelheim International Gmbh

Use of anti-cd40 antibodies for treatment of lupus nephritis

The present invention relates to new humanized antagonistic anti-cd40 antibodies and therapeutic and diagnostic methods and compositions for using the same for treating and/or preventing lupus nephritis.. .
Boehringer Ingelheim International Gmbh

Indole-like trk receptor antagonists

Wherein r1 is ch3, r2 is och3, r3 is so2n(ch3)2, and r4 is h; or r1 is ch3, r2 is oh, r3 is so2n(ch3)2, and r4 is h.. .

Biphenyl and phenyl-pyridine amides as p2x3 and p2x2/3 antagonists

Or a pharmaceutically acceptable salt thereof, wherein, r1 is optionally substituted phenyl or optionally substituted pyridinyl, and r2, r3, r4, r5, r6, r7, r8 and r9 are as defined herein. Also disclosed are methods of using the compounds for treating diseases associated with p2x3 and/or a p2x2/3 receptor antagonists and methods of making the compounds..

Cyclohexyl pyridine derivative

A problem of the present invention is to provide a new compound which has nk1 receptor antagonist activity, whose cyp3a4 inhibitory activity is reduced compared to aprepitant, and which are useful for the prevention or treatment of cancer-chemotherapy-induced nausea and vomiting. That is, the present invention relates to cyclohexyl pyridine derivatives represented by the following formula (i) or a pharmaceutically acceptable salt thereof.
Kissei Pharmaceutical Co., Ltd.

Crystal of pyrrole derivative and producing the same

The present invention provides a production intermediate of an atropisomer of a pyrrole derivative having excellent mineralocorticoid receptor antagonistic activity, a method for producing the same, and a crystal thereof. A method for producing an atropisomer of a pyrrole derivative including a step of resolving a compound represented by the following general formula (i) [wherein r1 represents a methyl group or a trifluoromethyl group, r2 represents a hydrogen atom or a c1-c3 alkoxy group, and n represents an integer selected from 1 to 3] into its atropisomers, characterized by using an optically active amine having a cinchonine skeletal formula, and a crystal of (s)-1-(2-hydroxyethyl)-4-methyl-n-[4-(methylsulfonyl)phenyl]-5-[2-(trifluoromethyl)phenyl]-1h-pyrrole-3-carboxamide..
Daiichi Sankyo Company, Limited

Thromboxane receptor antagonists

The invention generally relates to compounds that function as tp antagonists for treating thrombosis and other cardiovascular, renal, or pulmonary diseases. In some embodiments, the invention provides a compound including a substituted nitro phenoxy phenyl, a sulfonylurea, and an alkyl group.
University College Dublin, National University Of Ireland, Dublin

Methods of administering elagolix

The present disclosure relates to the use of gnrh receptor antagonists used in the treatment of endometriosis or uterine fibroids. In particular, the present disclosure describes a method of treating endometriosis or uterine fibroids, where the method involves the administration of elagolix, and where the method may further involve the co-administration of rifampin or ketoconazole..
Abbvie Inc.

Novel therapeutic use of p75 receptor antagonists

The present disclosure relates to the use of a p75 receptor antagonist or its pharmaceutically acceptable salts for the preparation of a medicament for use in the treatment and/or prevention of overactive bladder.. .
Sanofi

Substituted pyridines as p2x3 and p2x2/3 antagonists

Formula i: or a pharmaceutically acceptable salt thereof, wherein, x, y, r1, r2, r3, r4, r5, r6 and r7 are as defined herein.. .

Selective histamine h4 receptor antagonists for the treatment of vestibular disorders

The invention relates to histamine h4 receptor antagonists or inhibitors of histamine h4 receptor gene expression for the treatment and/or the prevention of vestibular disorders.. .
Inserm (institut National De La Sante De La Recherche Medicale)

Compositions of buprenorphine and u antagonists

.. .

Opioid receptor modulators and use thereof

Disclosed is an in vitro screening method for identifying an antagonist-to-agonist allosteric modifier of a mu-opioid receptor and an in vivo method for confirming that a test compound is such a modifier of a mu-opioid receptor. Also disclosed is a method for treating an opioid receptor-associated condition using a compound of formula (i) and a pharmaceutical composition containing the same..
Regents Of The University Of Minnesota

Composition for administering an nmda receptor antagonist to a subject

The invention provides extended release amantadine compositions for once daily administration of amantadine to a subject.. .
Adamas Pharmaceuticals, Inc.

Pharmaceutical compositions for the deterrence and/or prevention of abuse

Provided herein is a pharmaceutical composition comprising an antagonist, an agonist, a seal coat, and a sequestering polymer, wherein the antagonist, agonist, seal coat and at least one sequestering polymer are all components of a single unit, and wherein the seal coat forms a layer physically separating the antagonist from the agonist from one another. Methods for manufacturing such a pharmaceutical composition are also provided..
Alpharma Pharmaceuticals Llc

Adjuncts for surgical devices including agonists and antagonists

Adjuncts for surgical devices including agonists and antagonists are provided. In general, an implantable adjunct can have two or more medicants releasably disposed therein that are each releasable from the adjunct.
Ethicon Endo-surgery, Llc

Biomarkers and methods of treating pd-1 and pd-l1 related conditions

Provided herein are biomarkers for the treatment of pathological conditions, such as cancer, and method of using pd-1/pd-l1 pathway antagonists. In particular, provided are biomarkers for patient selection and prognosis in cancer, as well as methods of therapeutic treatment, articles of manufacture and methods for making them, diagnostic kits, methods of detection and methods of advertising related thereto..
Genentech, Inc.

Complaint actuator

An actuator (12) includes a moving member (18) pivotally connected to a base unit (14) for rotation about an axis. The driving force for rotation of the moving member (18) relative to the base unit (14) is provided by a pair of antagonistically operating shape memory alloy (sma) wires (48, 50) and transmitted via a torsional spring (56).
University Of Dundee

Diagnostic methods and compositions for treatment of glioblastoma

The invention provides methods and compositions to detect expression of one or more biomarkers for identifying and treating patients having glioblastomas who are likely to be responsive to vegf antagonist therapy. The invention also provides kits and articles of manufacture for use in the methods..
Genentech, Inc.

Methods and pharmaceutical compositions for the treatment of diseases mediated by the nrp-1/obr complex signaling pathway

The present invention relates to methods and pharmaceutical compositions for the treatment of diseases mediated by the nrp-1/obr complex signaling pathway. In particular, the present invention relates to a method for treating a disease selected from the group consisting of cancers, obesity and obesity related diseases, anorexia, autoimmune diseases and infectious diseases in a subject in need thereof comprising administering the subject with a therapeutically effective amount of an antagonist of the nrp-1/obr signaling pathway..
Universite De Bourgogne

Therapeutic drug for malignant tumors

The present invention makes it possible to obtain a novel therapeutic drug for malignant tumors. Specifically, the present invention provides a therapeutic drug for malignant tumors, said drug including an anti-lsr (lipolysis stimulated lipoprotein receptor) antibody or an antigen-binding fragment thereof, or a functional equivalent thereof, or an lsr inhibitor such as a nucleic acid.
National Institute Of Biomedical Innovation, Health And Nutrition

Methods of treating pain using anti-ngf antibodies that selectively inhibit the association of ngf with trka, without affecting the association of ngf with p75

This invention pertains to ngf antagonists including antibodies and fragments thereof (including fab fragments) having binding specificity to human nerve growth factor (hereinafter “ngf”), and methods of using one or more of said antibodies and fragments thereof to treat pain in an individual. More specifically the invention relates to methods of treating pain or eliciting an analgesic effect in an individual, comprising administering an effective amount of an ngf antagonist, e.g., an anti-human ngf antibody or fragment thereof or another moiety, such as a nucleic acid or polypeptide such as a fragment of ngf or trka which inhibits the association of ngf with trka, without appreciably inhibiting the association of ngf with p75.
Alderbio Holdings Llc

Ccr2 antagonist peptides

The invention relates to a peptide comprising the following amino acid sequence thr-phe-leu-lys or thr-phe-leu-lys-cys, useful as a ccr2 non competitive antagonist peptide.. .
Universite Pierre Et Marie Curie (paris 6)

Methods of developing selective peptide antagonists

Methods and compositions related to the selective, specific disruption of multiple ligand-receptor signaling interactions, such as ligand-receptor interactions implicated in disease, are disclosed. These interactions may involve multiple cytokines in a single receptor family or multiple ligand receptor interactions from at least two distinct ligand-receptor families.
Bioniz, Llc

Pharmaceutical compositions and methods

This invention relates the use of cortisol blockers (e.g., glucocorticoid receptor [gr] antagonists) for the treating or preventing viral infections, treating or preventing treatment resistant prostate cancer, treating or preventing neoplasia, and treating or preventing infection related to acute or chronic injury or disease.. .
Pop Test Oncology Limited Liability Company



Antagonist topics:
  • Antagonist
  • Recurrence
  • Proliferative Disorder
  • Proliferative
  • Antibodies
  • Progesterone
  • Dicyclomine
  • Scopolamine
  • Extracellular
  • Pharmaceutically Acceptable Salt
  • Metalloprotein
  • Nucleic Acids
  • Polynucleotide
  • Nucleic Acid
  • Monoclonal


  • Follow us on Twitter
    twitter icon@FreshPatents

    ###

    This listing is a sample listing of patent applications related to Antagonist for is only meant as a recent sample of applications filed, not a comprehensive history. There may be associated servicemarks and trademarks related to these patents. Please check with patent attorney if you need further assistance or plan to use for business purposes. This patent data is also published to the public by the USPTO and available for free on their website. Note that there may be alternative spellings for Antagonist with additional patents listed. Browse our RSS directory or Search for other possible listings.


    1.5813

    file did exist - 2569

    2 - 1 - 55